ID: 940966514

View in Genome Browser
Species Human (GRCh38)
Location 2:159843857-159843879
Sequence TTGTATAAACAATCTGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940966514_940966516 20 Left 940966514 2:159843857-159843879 CCCTGATCAGATTGTTTATACAA No data
Right 940966516 2:159843900-159843922 TCACACTGCACCTGATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940966514 Original CRISPR TTGTATAAACAATCTGATCA GGG (reversed) Intronic
No off target data available for this crispr