ID: 940969609

View in Genome Browser
Species Human (GRCh38)
Location 2:159881438-159881460
Sequence CAGGTAGAACATCTGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 489}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940969609 Original CRISPR CAGGTAGAACATCTGCAGGC TGG Intronic
901117758 1:6862198-6862220 CAGGTGGAACACCTGAAGTCAGG - Intronic
901324401 1:8358269-8358291 CACGTTGAACATCTGCAGTCGGG + Exonic
901389530 1:8934997-8935019 CAGGCAGATCACCTGCAGTCAGG - Intergenic
902043324 1:13508007-13508029 CAGGTAGATCACCTGAAGTCAGG + Intronic
902217093 1:14941145-14941167 CAGGTAGATCACCTGAAGTCAGG - Intronic
903415986 1:23183440-23183462 CAACTAGAAGAGCTGCAGGCTGG - Intergenic
904403239 1:30270503-30270525 CAGGTAGGAGATCAGCAGGCAGG - Intergenic
904403246 1:30270541-30270563 CAGGTAGGAGATGAGCAGGCAGG - Intergenic
904583449 1:31564841-31564863 CTGGAAGAAGATCTGCTGGCTGG + Intergenic
904641479 1:31934028-31934050 CAGGTAGATCACCTGAAGTCAGG + Intronic
905720729 1:40198526-40198548 CAGGTGGATCATCTGCGGTCAGG - Intronic
905729231 1:40284522-40284544 CAGGTGGATCACCTGCAGTCAGG + Intronic
906653136 1:47527745-47527767 CAGGTAGAATATGTGGAGGCTGG + Intergenic
907886771 1:58599235-58599257 CAGGTAGATCATCTGAGGTCAGG - Intergenic
908414284 1:63897900-63897922 ATGGCAGAACCTCTGCAGGCTGG - Intronic
909022808 1:70450810-70450832 CAGGCAGATCATCTGAAGTCAGG - Intergenic
909134415 1:71779794-71779816 CAGGTAGATCACCTGAAGTCAGG - Intronic
909626049 1:77717092-77717114 CAGGTGGATCATCTGAAGTCAGG - Intronic
910851250 1:91651638-91651660 GAGCAAGAGCATCTGCAGGCTGG - Intergenic
910953219 1:92673668-92673690 CAGGTAGAACATCAATAGACTGG + Intronic
913045664 1:115071833-115071855 GAGGTAGCACAGCTGCAGGCTGG + Intronic
913448258 1:118972825-118972847 CAGGTGGATCATCTGAAGTCAGG - Intronic
913611822 1:120516336-120516358 CAGGTAGAACACCTGAGGTCAGG - Intergenic
913975767 1:143453536-143453558 CAGGTAGATCACCTGAAGTCAGG + Intergenic
914070162 1:144279155-144279177 CAGGTAGATCACCTGAAGTCAGG + Intergenic
914108993 1:144687199-144687221 CAGGTAGATCACCTGAAGTCAGG - Intergenic
914579369 1:149005903-149005925 CAGGTAGAACACCTGAGGTCAGG + Intronic
914840639 1:151245761-151245783 CAGGCAGATCATCTGAAGCCAGG - Intronic
915119764 1:153622140-153622162 CAGGCAGATCATCTGAAGTCAGG + Intronic
915421663 1:155787543-155787565 CAGGCAGATCATCTGCGGTCAGG + Intronic
915863784 1:159476628-159476650 CAGATAGAGGATCTCCAGGCAGG - Intergenic
916881848 1:169026513-169026535 CAGGTGGATCATCTGAAGTCAGG + Intergenic
917792749 1:178509822-178509844 CAGGGAGAGCCTCTGCTGGCTGG + Intergenic
917945963 1:179971254-179971276 CAGGCAGATCACCTGCAGTCAGG - Intronic
918346023 1:183608067-183608089 CAGGTAGATCACCTGAAGTCAGG + Intergenic
918377609 1:183924715-183924737 CAGGTAGATCATCTGACGTCAGG + Intronic
919418837 1:197345733-197345755 CAGGTAGATCACCTGCGGTCAGG - Intronic
919870373 1:201816142-201816164 CAGGTAGATCATCTGAGGTCAGG + Intronic
921119030 1:212120603-212120625 CAGGTGGATCACCTGCAGTCGGG + Intergenic
921849488 1:219919546-219919568 CAGGTAGATCATCTGAAGTCAGG + Intronic
923585975 1:235271400-235271422 CAGGCGGATCATCTGCAGTCAGG + Intronic
924276453 1:242392377-242392399 CAGGGTGAACATGTGCAGGTTGG - Intronic
924495441 1:244584434-244584456 TAGGTAGAAGTTCAGCAGGCAGG + Intronic
1063422729 10:5926339-5926361 CAGGTAGATCACCTGAAGTCAGG - Intronic
1063636172 10:7785276-7785298 CAGGTTAAACATTTGCAGGGAGG - Intronic
1063668504 10:8081000-8081022 CAGGTAGACCATTCCCAGGCCGG + Intergenic
1064190671 10:13203070-13203092 CAGGCAGATCATCTGAAGTCAGG - Intronic
1064201809 10:13290867-13290889 CAGGTGGATCATCTGAAGTCAGG + Intronic
1064820409 10:19323836-19323858 CAGGTGGATCACCTGCAGTCAGG - Intronic
1065253595 10:23842093-23842115 CAGGCAGATCATCTGAAGACAGG - Intronic
1065422237 10:25557944-25557966 CAAGTAGGACATCTGCAGATGGG - Intronic
1068016747 10:51526045-51526067 CAGGTAGATCATCTGAAGTCAGG - Intronic
1068241656 10:54309564-54309586 CAGGTAGATCATCTGAGGTCAGG + Intronic
1068285787 10:54932762-54932784 CGGGTGGATCATCTGCAGTCAGG - Intronic
1069383987 10:67867595-67867617 CAGGTGGATCACCTGCAGTCAGG + Intergenic
1069419883 10:68237779-68237801 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1069442113 10:68438290-68438312 CAGGCAGATCATCTGAGGGCAGG + Intronic
1069735700 10:70652695-70652717 CAGGTAGTCCATCTGCTGGGAGG - Intergenic
1069796739 10:71058102-71058124 CAGTAGGAACGTCTGCAGGCCGG + Intergenic
1069895708 10:71679014-71679036 CAGGGAGGGCATCTGCAGGTGGG + Intronic
1071547255 10:86538164-86538186 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1072066758 10:91878956-91878978 CAGGTGGATCATCTGAAGTCGGG - Intergenic
1072115433 10:92365987-92366009 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1072137278 10:92558820-92558842 CAGGTGGATCACCTGCAGTCAGG - Intronic
1074131435 10:110581444-110581466 CAGGTGGATCATCTGAAGTCAGG - Intronic
1074217785 10:111404210-111404232 CAAGTAGAAAATCAGCAGCCAGG - Intergenic
1075251249 10:120876205-120876227 CAGGTAGATCATCTGAGGTCAGG - Intronic
1075323464 10:121511030-121511052 CAGGCAGATCACCTGCAGTCAGG - Intronic
1075324982 10:121524303-121524325 CTGGTAGAAAAACTGCAAGCAGG + Intronic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1075681474 10:124336326-124336348 CATGTAGAGAATCTGCATGCTGG + Intergenic
1078212441 11:9280530-9280552 CAGGTGGATCACCTGCAGTCAGG - Intergenic
1078487744 11:11739770-11739792 CATGGAGAGCATGTGCAGGCAGG + Intergenic
1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG + Intronic
1081128824 11:39351217-39351239 CAGGTAGATCACCTGAAGTCAGG - Intergenic
1081293751 11:41359953-41359975 CAGGCAGATCATCCGCAGTCAGG + Intronic
1081675073 11:44963907-44963929 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1081816285 11:45944988-45945010 CAGGCAGATCATCTGAAGTCAGG - Intronic
1081984756 11:47293528-47293550 CAGGTAGATCACCTGAAGTCAGG - Intronic
1082703689 11:56466023-56466045 CGGGTAGAACATCTGAGGTCAGG + Intergenic
1083635183 11:64117076-64117098 CAGGTAGAGCTTCTGCAGGTGGG - Exonic
1085454935 11:76660342-76660364 CAGGTTGAGCCGCTGCAGGCTGG + Exonic
1086606434 11:88701701-88701723 AAGGTAGAACATCTTGAAGCAGG + Intronic
1086745408 11:90420454-90420476 CAGGTAGATCACCTGAAGTCAGG - Intergenic
1086929007 11:92671876-92671898 CAGGTGGATCATCTGAAGTCAGG + Intronic
1087564155 11:99832891-99832913 CAGGCAGAACAGTTGCAGCCTGG + Intronic
1087733500 11:101805559-101805581 CAGGCAGATCATTTGCAGCCAGG - Intronic
1087803191 11:102526462-102526484 CAGGTGGATCATCTGCGGTCAGG - Intronic
1087932163 11:103990537-103990559 CAGGCAGAACCTCTGCTGTCAGG - Intronic
1089530481 11:119125264-119125286 CAGGTGGATCATCTGAAGTCAGG - Intronic
1089691917 11:120192279-120192301 CAGGTCGGCCATCTGCAGGAAGG - Intergenic
1089872783 11:121691436-121691458 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1091172939 11:133534418-133534440 CAGGTAGAAACCCTGCAGGGGGG + Intergenic
1091588838 12:1831142-1831164 CAGGTCCAACCGCTGCAGGCTGG - Exonic
1092304138 12:7282223-7282245 AAGGCAGAACAACTGCAAGCAGG - Intergenic
1092346323 12:7718069-7718091 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1092770213 12:11889928-11889950 TAGGTGGAACATCTGCAACCAGG + Intronic
1093224809 12:16469414-16469436 CAGGCAGATCATCTGAAGTCAGG - Intronic
1093801558 12:23379647-23379669 CAGGTAGAACACCTGAGGTCAGG + Intergenic
1094589899 12:31810276-31810298 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1095416337 12:41981255-41981277 CAGGAAAAACATCTGCAAACAGG - Intergenic
1096190088 12:49611143-49611165 CAGGTGGATCATCTGAAGTCAGG + Intronic
1096572449 12:52531419-52531441 CATGGAAAACAACTGCAGGCTGG - Intergenic
1097115246 12:56692158-56692180 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1097214756 12:57402065-57402087 CAGGTAGATCTTCTGAAGTCAGG + Intronic
1098151097 12:67547455-67547477 CAGGTAGATGATCTGGAAGCAGG - Intergenic
1098552133 12:71774529-71774551 CAGGTAGATCATCTGAGGTCAGG + Intronic
1099026791 12:77474642-77474664 CATGCAGAACATCTGCAGACTGG - Intergenic
1100249817 12:92807179-92807201 CAGGCAGATCATCTGAAGTCAGG - Intronic
1100642216 12:96492763-96492785 CAGGCAGATCACCTGCAGTCAGG + Intronic
1101035637 12:100703084-100703106 CAGGCAGATCATCTGAGGGCAGG - Intergenic
1101127649 12:101653973-101653995 CAGGCAGAACACCTGAAGCCAGG + Intronic
1101324680 12:103704947-103704969 CAGGTGGAATATATCCAGGCTGG - Intronic
1102376553 12:112426482-112426504 CAGGTAGATCACCTGAAGTCAGG - Intronic
1102820666 12:115906762-115906784 CAGGTGGATCATCTGAAGTCAGG + Intergenic
1102911153 12:116715159-116715181 CAGGTGGATCACCTGAAGGCAGG - Exonic
1103134586 12:118496816-118496838 CAGGTAGGTCACCTGAAGGCAGG + Intergenic
1103366132 12:120384788-120384810 CAGCTGGGACAGCTGCAGGCAGG - Intergenic
1103812155 12:123623699-123623721 CAGGTAGATCATCTGAGGTCAGG - Intronic
1104233789 12:126911786-126911808 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1104358351 12:128109148-128109170 CGGGTTGCACATCTGCATGCCGG - Intergenic
1106347632 13:28894412-28894434 GAGGTTGACCATCTGCAAGCCGG + Intronic
1107776199 13:43845481-43845503 CAGGTAGACCACCTGAAGTCAGG + Intronic
1108194718 13:47981587-47981609 CAGGCAGAACACCTGAAGTCAGG + Intronic
1108357766 13:49642673-49642695 CAGGTGGATCACCTGCAGTCAGG + Intergenic
1109636161 13:65120285-65120307 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1109790532 13:67241801-67241823 CGGGTAGATCACCTGCAGTCAGG + Intergenic
1111843856 13:93485079-93485101 CAGATAGAACATCTCCAGGGGGG - Intronic
1113935619 13:113993578-113993600 CAGGTGGATCATCTGAAGTCAGG + Intronic
1114127708 14:19749369-19749391 CAGGCAGATCATCTGAAGTCAGG + Intronic
1114389525 14:22291927-22291949 CAGGCAGATCACCTGCAGTCAGG + Intergenic
1114471907 14:22968956-22968978 CAGGTAGAACACCTGAGGTCAGG - Intronic
1115535977 14:34373789-34373811 CAGGTAGATCACCTGCGGTCAGG + Intronic
1115750737 14:36487192-36487214 CAGGCAGATCATCTGAAGTCAGG + Intronic
1116165633 14:41330903-41330925 CAGTTTGAACATATCCAGGCAGG - Intergenic
1116876734 14:50119761-50119783 CAGGCAGATCATCTGAAGTCAGG - Intronic
1117314222 14:54558103-54558125 CAGGAAGAAAATGTGCTGGCAGG - Intergenic
1117866583 14:60155881-60155903 CATGTAGAACATTTGGAGCCGGG + Intronic
1118212179 14:63775501-63775523 CAGGTAGATCACCTGAAGTCAGG - Intergenic
1118272200 14:64353849-64353871 CAGGCAGATCACCTGCAGTCAGG + Intergenic
1118844594 14:69537543-69537565 CAGGTAGATCACCTGCGGTCAGG - Intergenic
1119282161 14:73418542-73418564 CAGGTAGATCATCTGAGGTCAGG + Intronic
1120929634 14:89835853-89835875 CAGGTAGATCATCTGAGGTCAGG - Intronic
1121344492 14:93125297-93125319 CAGGCAGATCATCTGAGGGCGGG + Intergenic
1121787439 14:96673063-96673085 CAGGTAGATCACCTGAAGTCAGG - Intergenic
1121997492 14:98614858-98614880 CAGGTTGTAATTCTGCAGGCTGG - Intergenic
1124134993 15:27027432-27027454 CAGGCAGGACCTCCGCAGGCGGG - Intronic
1124372682 15:29112286-29112308 CAGGGAGAACCGCTGCAGGTCGG - Intronic
1124477821 15:30050587-30050609 CAGGCAGAACATCTGAGGTCAGG + Intergenic
1124996451 15:34727633-34727655 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1125085155 15:35721420-35721442 CATGCAGCACACCTGCAGGCAGG + Intergenic
1125526164 15:40376390-40376412 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1125619283 15:41045359-41045381 CAGGTGGAACATCTGAGGTCAGG + Intronic
1125981413 15:44005251-44005273 CAGGCAGATCATCTGAAGTCAGG + Intronic
1126398252 15:48242320-48242342 CAGGGAAAACAGCTCCAGGCTGG + Intronic
1127416986 15:58767881-58767903 CAGGCAGATCACCTGCAGTCGGG - Intergenic
1127481008 15:59377239-59377261 CAGGTAGATCACCTGAAGTCAGG + Intronic
1127793664 15:62420376-62420398 CAGGTAGGACATCTACACACAGG - Intronic
1129557406 15:76527101-76527123 CAGGTGGATCATCTGCGGTCAGG - Intronic
1129705038 15:77789377-77789399 CAAGTGGATCATCTGCAGTCAGG + Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130348157 15:83067414-83067436 GAGGTGGAGCTTCTGCAGGCTGG + Intergenic
1131009911 15:89008684-89008706 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1132116566 15:99140595-99140617 CAGGTGGATCACCTGCAGTCAGG - Intronic
1132892027 16:2209277-2209299 CAGGGAGGACAGCTGCTGGCAGG - Exonic
1133172601 16:3991025-3991047 CAGGTAGATCACCTGAAGTCAGG - Intronic
1133546374 16:6811660-6811682 CGGGTAGATCATCTGAAGTCAGG + Intronic
1134253373 16:12590792-12590814 CAGGTAGATCATTTGAAGTCAGG + Intergenic
1134485318 16:14653551-14653573 CAGGTAGATCATCTGAGGTCAGG - Intronic
1134688378 16:16174527-16174549 CAGGTGGAACACCTGAAGTCAGG + Intronic
1134899002 16:17917629-17917651 CAGGTACAACATCTGCTGAGGGG + Intergenic
1135377779 16:21964290-21964312 CAGGCAGAATAGATGCAGGCTGG - Intronic
1135616726 16:23917308-23917330 CAGGTGGATCATCTGAAGTCAGG - Intronic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1136932791 16:34434185-34434207 CAGGTGGATCATCTGAAGTCGGG + Intergenic
1136971781 16:34977629-34977651 CAGGTGGATCATCTGAAGTCGGG - Intergenic
1138233725 16:55361492-55361514 CAGGTGGATCACCTGCAGTCAGG + Intergenic
1138540998 16:57687477-57687499 CAGGTAGATCATCTGAGGTCAGG - Intronic
1139451975 16:67035310-67035332 CAGGTAGACCATCTGAGGTCAGG - Intronic
1139514782 16:67446592-67446614 GGGGTAGAAAATATGCAGGCTGG - Intronic
1139632571 16:68239481-68239503 AAGGTAGAAAATCTGGAGGAAGG - Intergenic
1139829521 16:69785852-69785874 CAGGTAGATCATCTGAGGTCAGG - Intronic
1139944979 16:70634381-70634403 GAGATAGAACATTTCCAGGCTGG + Intronic
1140453597 16:75091129-75091151 CAGGTAGATCATCTGAGGTCAGG + Intronic
1141150286 16:81559918-81559940 CAGGTAGATCATCTGAGGTCAGG + Intronic
1141922923 16:87148036-87148058 CAGGTAGATCACCTGAAGTCAGG + Intronic
1142250707 16:88990528-88990550 CAGGTCGGACAACAGCAGGCCGG - Intergenic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1142468710 17:150152-150174 CAGGGAGGTCATGTGCAGGCTGG + Intronic
1142568643 17:857486-857508 CAGGCAGATCATCTGAGGGCAGG - Intronic
1142673043 17:1496281-1496303 CAGGTACATCACCAGCAGGCAGG - Intronic
1142788886 17:2247558-2247580 CAGGTAGATCATCTGCGGTCAGG + Intronic
1143536250 17:7541729-7541751 CAGGTGGATCATCTGAAGTCAGG + Intergenic
1144554449 17:16269418-16269440 CAGGTGGATCATCTGCAGTCAGG + Intronic
1146197845 17:30828259-30828281 CAGGTGGATCATCTGGAGTCAGG - Intergenic
1146685293 17:34837377-34837399 CTGGTAGAACATCTTCAGGGTGG - Intergenic
1146778577 17:35645620-35645642 CAGGTAGATCATCTGAGGTCAGG + Intronic
1147037404 17:37691993-37692015 CAGTTAGAACAAGTGCAGGCAGG - Intronic
1148032939 17:44634754-44634776 CAGGCAGATCATCTGGAGTCAGG - Intergenic
1149094173 17:52820690-52820712 CAGGTAGATCACCTGAAGTCAGG + Intergenic
1149314775 17:55428649-55428671 CAGGTGGATCATCTGCGGTCAGG + Intergenic
1149799951 17:59557987-59558009 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1150541022 17:66099274-66099296 CAGGCAGATCACCTGCAGTCAGG + Intronic
1150707271 17:67498364-67498386 CGGGCAGATCATCTGCAGTCAGG + Intronic
1151295977 17:73186466-73186488 CAGGCAGCACATCCGCAGGTGGG - Intergenic
1152824071 17:82453064-82453086 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1153701568 18:7699635-7699657 CAGGCAGATCACCTGCAGTCAGG - Intronic
1155365140 18:25042187-25042209 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1157839305 18:50941028-50941050 CAGGTGGAACATCTGAGGTCAGG + Intronic
1157869598 18:51217981-51218003 CAGGTAGAGCATCTGAGGTCAGG - Intronic
1158419251 18:57278420-57278442 CAGGAAGATCCTTTGCAGGCTGG + Intergenic
1158474519 18:57768156-57768178 CAGGCAGATCACCTGCAGTCAGG + Intronic
1158601155 18:58856964-58856986 CAGGTGGATCATCTGCGGTCAGG - Intergenic
1160057336 18:75495795-75495817 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1160369305 18:78358348-78358370 CAGGCAGAGCATCTGCGGGGTGG + Intergenic
1160722911 19:605050-605072 CATGTGGAAGATCTGCAGGAAGG - Exonic
1160946538 19:1646416-1646438 CAGCGGGAACATCTGCAGGGAGG + Exonic
1160996887 19:1886319-1886341 CAGGTAGATCACCTGAAGTCAGG + Intergenic
1161246640 19:3256227-3256249 AAGGTAGAAATTCTCCAGGCGGG - Intronic
1161359959 19:3842850-3842872 CAGGTGGAGCACCTGCAGTCAGG - Intronic
1161483569 19:4523150-4523172 CAGGTGGATCATCTGAAGTCAGG - Exonic
1162735946 19:12747186-12747208 CATGTTGCACATCTGCAGGGGGG - Exonic
1162813463 19:13178954-13178976 CAGGTGGATCACCTGCAGTCAGG - Intergenic
1163534227 19:17867865-17867887 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1165044859 19:33096854-33096876 CAGGTGGATCATCTGAAGTCAGG - Intronic
1165050496 19:33138572-33138594 CAGGTGGATCATCTGAAGTCAGG - Intronic
1165355796 19:35303149-35303171 CAGGCAGATCATCTGAAGTCAGG - Intronic
1165920614 19:39295648-39295670 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1166552154 19:43673096-43673118 CAGGTTGATCATCTGAAGTCAGG - Intergenic
1167239390 19:48334186-48334208 CTGCCCGAACATCTGCAGGCGGG + Exonic
1167520536 19:49951953-49951975 CAGGGTGAAGATCTGCAGGAAGG - Exonic
1167953829 19:53048448-53048470 CAGGTAGATCATCTGAGGTCAGG + Intronic
1168046572 19:53798394-53798416 CAGGTTGGGCATCTGCCGGCTGG - Exonic
1168306112 19:55437158-55437180 CAGCCTGAACATCTGCAGGGTGG + Intronic
1168337157 19:55603175-55603197 GAGGAAGAACATTTGAAGGCAGG - Intergenic
1202651736 1_KI270707v1_random:11370-11392 CAGGTGGATCATCTGCGGTCAGG + Intergenic
926028049 2:9561871-9561893 CAGGCAGATCATCTGAAGTCAGG - Intergenic
926167688 2:10531621-10531643 CAGGTAGATCACCTGAAGTCAGG + Intergenic
926814315 2:16785361-16785383 CATGTATAAAATCTGCAGCCAGG - Intergenic
927275858 2:21261829-21261851 CAGGCAGAGAATGTGCAGGCAGG + Intergenic
927331972 2:21875931-21875953 CAGGTAGATCATCTGAGGTCAGG - Intergenic
927597923 2:24413655-24413677 CAGGTAGATCACCTGAAGTCAGG - Intergenic
927924347 2:26999727-26999749 CAGGTGGAACATCTGAGGTCAGG - Intronic
929430947 2:41885877-41885899 CAGGTAGATCATCTGAGGTCAGG + Intergenic
929514474 2:42594177-42594199 CAGGTGGATCATCTGAAGTCAGG - Intronic
929522804 2:42670030-42670052 CAGGTAGATCATCTGAGGTCAGG + Intronic
929552332 2:42902480-42902502 CAGGTGGATCACCTGCAGTCGGG + Intergenic
929735314 2:44541899-44541921 CAGGCAGATCACCTGCAGTCAGG + Intronic
930346623 2:50190838-50190860 CAGGTGGATCACCTGCAGTCGGG - Intronic
930663786 2:54082064-54082086 CAGGGAGAGCAGCTCCAGGCTGG - Intronic
931362667 2:61591415-61591437 CAGGTGGATCACCTGCAGTCAGG + Intergenic
932513554 2:72321305-72321327 CAGGTAGAACACCTGAGGTCAGG + Intronic
933156254 2:78979084-78979106 CAGGCAGATCACCTGCAGTCAGG - Intergenic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
934180466 2:89614508-89614530 CAGGTAGATCACCTGAAGTCAGG + Intergenic
934290766 2:91688771-91688793 CAGGTAGATCACCTGAAGTCAGG + Intergenic
934756366 2:96827493-96827515 CAGGTGGATCACCTGCAGTCAGG - Intronic
935006844 2:99087277-99087299 CAGGCAGATCACCTGCAGTCAGG + Intronic
935898133 2:107759813-107759835 CAGGGTGAACATCTCCAGACAGG + Intergenic
936166834 2:110128257-110128279 GAGGCAGAACATGTGCAGGAGGG - Intronic
936372555 2:111914504-111914526 CAGGTAGATCACCTGAAGTCAGG - Intronic
936953005 2:117997213-117997235 CAGGTGGATCTTCTGCAGGGTGG - Intronic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
938754318 2:134365660-134365682 CAGATAGAACTCCTGCAGCCTGG + Intronic
938901335 2:135800875-135800897 CAGAGGGGACATCTGCAGGCAGG - Intronic
939932682 2:148254606-148254628 CAGGTACAACGTCTGCTGGTAGG + Intronic
940146983 2:150555791-150555813 CAAGTGGAAAATCTGCTGGCTGG - Intergenic
940315806 2:152326449-152326471 CAGGTTCAAAATCTGCAGGGTGG + Intergenic
940479210 2:154206565-154206587 CAGGTGGATCAGCTGAAGGCAGG + Intronic
940969609 2:159881438-159881460 CAGGTAGAACATCTGCAGGCTGG + Intronic
941136717 2:161726679-161726701 CAGGCAGATCATTTGCAGTCAGG + Intronic
941798341 2:169626615-169626637 CAGGCAGAACACCTGAAGTCAGG - Intronic
942529161 2:176889716-176889738 CAGGAAGAGCATCAGCTGGCAGG + Intergenic
944681254 2:202078966-202078988 CAGGTAGATCATCTGAGGTCAGG + Intronic
946013692 2:216587171-216587193 CAGGTAGATCATCTGAGGTCGGG - Intergenic
946030969 2:216704780-216704802 CAGGTGGATCATCTGAAGTCAGG - Intergenic
946250649 2:218409463-218409485 CAGGTGGAACACCTGAAGTCAGG + Intergenic
947293525 2:228604190-228604212 CAGGTGGATCACCTGCAGTCAGG + Intergenic
947966313 2:234284411-234284433 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1168849697 20:968050-968072 CAGGAAGAGCCTCTGCTGGCAGG + Exonic
1170603897 20:17861760-17861782 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1170773353 20:19353312-19353334 AAGGTAGGTCATCTACAGGCAGG + Intronic
1172075117 20:32290153-32290175 CAGGTAGAACACCTGAGGTCAGG + Intronic
1172409493 20:34710810-34710832 CAGGTAGAGCCTGTGCAGCCTGG + Exonic
1174138566 20:48397468-48397490 CAGGTGGAATCTTTGCAGGCAGG + Intergenic
1174149659 20:48477102-48477124 CAAGTCCAAAATCTGCAGGCTGG - Intergenic
1174264889 20:49324179-49324201 CGGGTAGAACACGTGCAGGGTGG + Intergenic
1174344548 20:49920338-49920360 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1174461122 20:50683682-50683704 CAGGTGGATCACCTGCAGTCAGG - Intronic
1175203001 20:57290848-57290870 CAGGTGGAGCAGCAGCAGGCTGG - Intergenic
1175223453 20:57431215-57431237 CAGGTGGATCATCTGAAGCCAGG + Intergenic
1175346702 20:58284318-58284340 CAGGTAGATCACCTGAAGTCAGG + Intergenic
1175574190 20:60048298-60048320 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1175865927 20:62176585-62176607 CGGGTAGATCACCTGCAGTCAGG + Intronic
1178111979 21:29377989-29378011 CAGGTAGATCATTTGAAGTCAGG + Intronic
1178464224 21:32832130-32832152 CAGGTAGATCACCTGAAGTCAGG - Intergenic
1178586275 21:33873931-33873953 CAGGCAGAACATCTGAGGTCAGG + Intronic
1178600124 21:33987574-33987596 CAGGTAGGACCTTGGCAGGCAGG + Intergenic
1179526329 21:41978583-41978605 CAGGTAGATCACCTGAAGTCAGG - Intergenic
1179563540 21:42232292-42232314 CAGGGAGAAAATGTGCTGGCTGG - Intronic
1179900592 21:44391492-44391514 CACGTGGTGCATCTGCAGGCGGG - Exonic
1180575869 22:16773570-16773592 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1180609942 22:17089021-17089043 CAGGTAGATCATTTGAAGTCAGG - Intronic
1180818145 22:18805978-18806000 CCGGGAGCGCATCTGCAGGCAGG + Intergenic
1181204365 22:21240433-21240455 CCGGGAGCGCATCTGCAGGCAGG + Intergenic
1181372618 22:22430166-22430188 CAGGAAGCACATCTGTGGGCAGG + Intergenic
1181480365 22:23195047-23195069 CAGGCAGAACATCTGAGGTCAGG + Intronic
1183637644 22:39074419-39074441 CGGGTGGATCATCTGCAGTCGGG + Intronic
1185091059 22:48773675-48773697 CAGGTAGATCATCTGATGTCAGG - Intronic
1185139081 22:49090242-49090264 CAGGGAGCACAGCTGCTGGCTGG - Intergenic
1203222557 22_KI270731v1_random:54982-55004 CCGGGAGCGCATCTGCAGGCAGG - Intergenic
1203268272 22_KI270734v1_random:31832-31854 CCGGGAGCGCATCTGCAGGCAGG + Intergenic
949124794 3:434113-434135 GAGGCAGAACATCTGCGGTCAGG - Intergenic
949229584 3:1734838-1734860 CAAGCCCAACATCTGCAGGCAGG + Intergenic
950066188 3:10113835-10113857 CAGGTAGATCATCTGAGGTCAGG + Intergenic
950385586 3:12656767-12656789 CAGGTGGATCATCTGCAGTCAGG + Intronic
950403988 3:12793178-12793200 CAGGTAGATCACCTGAAGTCAGG + Intergenic
950766177 3:15274771-15274793 CAGGTAGATCATCTGAGGTCAGG - Intronic
950782776 3:15406855-15406877 CAGGTGGATCATCTGAAGTCAGG - Intronic
950951122 3:17000216-17000238 TATGTAGTACATTTGCAGGCTGG + Intronic
951711758 3:25590745-25590767 CGGATAGATCATCTGCAGTCAGG - Intronic
952983766 3:38759404-38759426 CAGGTAGGATGTCTCCAGGCTGG - Intronic
953347395 3:42187692-42187714 CAGGCAGATCATCTGAAGTCAGG - Intronic
953447948 3:42983502-42983524 CTGGACGAACATCTGCAGGCTGG - Intronic
954343974 3:49980530-49980552 CAGGTAGATCATCTGAGGTCAGG + Intronic
954660493 3:52224417-52224439 CAGGAAGAACTTCTGCAGGTAGG - Intronic
956543528 3:70372525-70372547 CAGGTGGATCATCTGCGGTCAGG - Intergenic
956770994 3:72525881-72525903 CAGGTAGATCACCTGAAGTCAGG + Intergenic
957342543 3:78919613-78919635 CAGGGAGATCATGTCCAGGCAGG - Intronic
958671227 3:97207873-97207895 CAGGCAGATCATCTGTAAGCTGG - Intronic
959194788 3:103166351-103166373 TAAGTAAAACATCTTCAGGCAGG - Intergenic
959265483 3:104132027-104132049 CAGGCAGATCATCTGCAGTTGGG - Intergenic
959837872 3:110942284-110942306 CAGGTGGAACACCTGAAGTCAGG + Intergenic
959923448 3:111895618-111895640 CAGGTAGATCACCTGCGGTCAGG + Intronic
960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG + Intronic
960798258 3:121511550-121511572 CAGGCAGATCACCTGAAGGCTGG + Intronic
961480280 3:127175037-127175059 CAGGAAGAAGGTCTGCAGGTAGG + Intergenic
962114461 3:132487812-132487834 CAGGTAGTACATCTGCTACCAGG - Intronic
963055743 3:141185147-141185169 CAGGTAGATCATCTGAGGTCAGG - Intergenic
964190561 3:153995724-153995746 CAGGTATTATATCTGTAGGCAGG - Intergenic
965118498 3:164521372-164521394 CAGGCACACCATCTGCAGCCAGG + Intergenic
965573969 3:170199057-170199079 CAGGCAGATCACCTGCAGTCAGG - Intergenic
965732766 3:171790226-171790248 CAGGTAGACCATGAGCAGGCTGG - Intronic
966065639 3:175818122-175818144 CAGGTAGATCACCTGAAGTCAGG - Intergenic
966142854 3:176775581-176775603 CAGGTGGATCACCTGCAGTCAGG - Intergenic
966945446 3:184774170-184774192 CAGGAGGAAGATCTGCAGACCGG + Intergenic
967098455 3:186196364-186196386 CAGGTGGAACACCTGCAGTCAGG - Intronic
968900094 4:3426862-3426884 TACCTAGAACATCTGCAGGTGGG - Intronic
969831965 4:9805064-9805086 CAGGCAGGAGATCTGCAGGCCGG - Intronic
970203584 4:13633469-13633491 CAGGTGGATCACCTGAAGGCAGG + Intergenic
971762130 4:30780276-30780298 CAGGTAGATCATCTGAGGTCAGG + Intronic
971984740 4:33807298-33807320 CAGGCAGATCACCTGAAGGCAGG - Intergenic
972447552 4:39159930-39159952 CAGGCAGATCATCTGAAGTCAGG + Intergenic
972506664 4:39726221-39726243 CAGGTAGAACACCTGAGGTCAGG - Intronic
972535996 4:40000380-40000402 CAGGTGGATCATCTGAAGTCAGG + Intergenic
973984727 4:56339521-56339543 CAGGCAGATCACCTGCAGTCAGG + Intronic
974481470 4:62449159-62449181 CAAGTCTAAAATCTGCAGGCTGG - Intergenic
974540190 4:63224068-63224090 CAGGCAGATCACCTGCAGTCAGG - Intergenic
974879971 4:67743177-67743199 CAGGTGGACCACCTGCAGTCAGG - Intronic
976119640 4:81765550-81765572 CAGGTAGATCATCTGGGGTCAGG + Intronic
976402152 4:84619803-84619825 CAGGTGGAACATCTGAAGTCGGG + Intronic
976507682 4:85868131-85868153 AAGGCAGAACATCTGGAAGCAGG + Intronic
976544942 4:86324177-86324199 CAGGCAGATCACCTGCAGTCAGG + Intronic
976817063 4:89161283-89161305 CAGGTAGAACATCTGAAATATGG + Intergenic
977786438 4:101040547-101040569 CAGGTGCAACAGCTGCAGCCCGG - Exonic
977989161 4:103420438-103420460 CAGGTGGATCATCTGAAGTCAGG - Intergenic
979072408 4:116224679-116224701 CAGGTGGATCATCTGAAGTCAGG - Intergenic
979133942 4:117085289-117085311 CAGGAAGAACATCCCCACGCAGG + Exonic
981990748 4:150917697-150917719 CAGGCAGATCATCTGCGGTCAGG + Intronic
982140639 4:152314272-152314294 CAGGTAGAACACCTGAGGTCAGG - Intergenic
983139556 4:164132940-164132962 CAGCAAGAACATCTTCAAGCTGG + Intronic
983779597 4:171651306-171651328 CAGGTAGAGCTTGTGCAGGTGGG - Intergenic
985696073 5:1340991-1341013 CAGGTGGATCACCTGCAGTCAGG - Intronic
987567033 5:19602734-19602756 CAGGTGGATCACCTGCAGTCAGG + Intronic
987828024 5:23059015-23059037 CAGGTAGATCATCTGAGGTCAGG - Intergenic
989055514 5:37362513-37362535 CAGGCAGATCACCTGCAGTCGGG - Intronic
989118794 5:37982875-37982897 CAGGTAGATCATCTGAGGTCAGG - Intergenic
989614090 5:43321971-43321993 CAGTTAGAAAGTCTGCAGGTGGG + Intergenic
990164801 5:52982550-52982572 CAGGCAGATCATCTGAAGTCAGG + Intergenic
990260340 5:54015063-54015085 CAGGTAGATCACCTGAAGTCAGG + Intronic
990519051 5:56560180-56560202 CAGGAAGAAAATCTGCATGAGGG - Intronic
992195063 5:74330886-74330908 CAGCTAGAATATAAGCAGGCAGG - Intergenic
992628356 5:78655476-78655498 CAGGTAGATCACCTGAGGGCAGG + Intronic
994169538 5:96643508-96643530 CAGGTGGAACATCTGAGGTCAGG + Intronic
994356331 5:98797821-98797843 CAGGGAGAAAATCTGCAGCAAGG - Intronic
994428045 5:99620491-99620513 CAGGTAGATCACCTGAAGTCAGG + Intergenic
994720403 5:103373436-103373458 CAGGTGGATCATCTGAAGTCAGG - Intergenic
994835999 5:104853231-104853253 CAGGTGGATCATCTGAAGTCGGG - Intergenic
995743896 5:115383592-115383614 CAGGAAGAACTACTGCAGGAAGG + Intergenic
996010347 5:118475469-118475491 CAGGTAGAGCATCTGTAAGGAGG - Intergenic
996434399 5:123418808-123418830 CAGGTAGATCACCTGAAGTCAGG - Intronic
997829948 5:137140985-137141007 CAGGTGGATCATCTGAAGTCGGG - Intronic
998457371 5:142283788-142283810 CAGGTACAACATATGCTTGCTGG - Intergenic
998944881 5:147327813-147327835 CATGCTGAGCATCTGCAGGCTGG - Intronic
999290315 5:150421068-150421090 CAGGTGGATCATCTGAAGTCAGG - Intergenic
999452622 5:151689713-151689735 CAGGTAGATCACCTGCGGTCAGG + Intergenic
999641370 5:153676619-153676641 CATATAACACATCTGCAGGCTGG - Intronic
999800799 5:155033647-155033669 CAGGTAGATCACCTGAGGGCAGG - Intergenic
999839801 5:155412913-155412935 CAGGCAGAACCTCAGCAGACAGG + Intergenic
999991515 5:157054270-157054292 CAGGCAGAACATCTGAGGTCAGG + Intronic
1000037132 5:157457698-157457720 CAGGTGGAACACCTGAAGTCAGG + Intronic
1000364559 5:160478862-160478884 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1000373877 5:160561369-160561391 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1001048667 5:168396154-168396176 CAGGCAGATCACCTGCAGTCAGG + Intronic
1001448306 5:171804794-171804816 CAGGTGGATCACCTGCAGTCAGG + Intergenic
1002615172 5:180448620-180448642 CTGGGAGAACAGGTGCAGGCCGG + Intergenic
1002716944 5:181233916-181233938 CAGGTAGACCTAGTGCAGGCAGG + Intronic
1003517415 6:6828344-6828366 CAGGGAGTACATATGCAGGTTGG - Intergenic
1004224714 6:13775024-13775046 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1004377283 6:15101816-15101838 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1005611861 6:27533638-27533660 CAGGTGGATCACCTGCAGTCAGG + Intergenic
1006095786 6:31655956-31655978 TTGGTGGAACATCTTCAGGCAGG - Exonic
1006102722 6:31695801-31695823 CAGGCAGATCGTCTGCAGTCAGG + Intronic
1006395447 6:33784079-33784101 AAGGAAGAACAGCTGCAGGAAGG + Intronic
1007594379 6:43042566-43042588 CAGGCAGATCATCTGAGGGCAGG - Intronic
1007825006 6:44593886-44593908 CAGGAAGAACAGATGCAGCCAGG + Intergenic
1008463654 6:51805498-51805520 CAGATGGTACATGTGCAGGCTGG - Intronic
1010749671 6:79604030-79604052 CAGGTAGAACACCTGAGGTCAGG - Intergenic
1011629151 6:89308040-89308062 CAGGTAGATCACCTGAGGGCAGG - Intronic
1013192604 6:107816383-107816405 CAGGAAGAACATCTCCAGGGAGG + Intronic
1013348945 6:109289162-109289184 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1014142566 6:117961314-117961336 AAGCTAGAACTACTGCAGGCAGG + Intronic
1015305806 6:131706255-131706277 TAGGCAGATCATCTGCAGTCAGG - Intronic
1015370667 6:132448605-132448627 CAGGTAGATCACCTGAAGTCAGG + Exonic
1015852061 6:137584325-137584347 CAGGGAGAAGCTCTGCAGGGAGG + Intergenic
1016908688 6:149176216-149176238 CAGCTAGAATATAAGCAGGCAGG - Intergenic
1016968492 6:149741024-149741046 CAGATAAAACATCTGGAAGCAGG - Intronic
1017144754 6:151224585-151224607 CAGGTAGCATCTCTGCAGGTAGG - Intergenic
1017377826 6:153791185-153791207 CAGGTTCAAAATCTGCAGGGTGG + Intergenic
1017464105 6:154678642-154678664 CAGGTGGATCACCTGCAGTCAGG + Intergenic
1017923680 6:158892745-158892767 CAGGTGGATCATCTGAAGTCAGG + Intronic
1018819216 6:167360152-167360174 CAGGCAGATCATCTGAAGTCAGG - Intronic
1019386970 7:762839-762861 CAGGTGGATCACCTGCAGTCAGG - Intronic
1019622005 7:1997251-1997273 CAGGTAAAGGAGCTGCAGGCTGG + Intronic
1020254672 7:6496409-6496431 CAGTTAAAACCTCTGCAGGCAGG - Intergenic
1020735120 7:11938739-11938761 CAGGCAGATCACCTGCAGTCAGG - Intergenic
1021454293 7:20812903-20812925 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1022053280 7:26701503-26701525 CAGGTAGATCACCTGCAGTCAGG + Intronic
1023758609 7:43443563-43443585 CCAGTAGAACAGCTGCAGGAAGG + Intronic
1024546459 7:50525534-50525556 CAGGCAGATCACCTGCAGTCAGG + Intronic
1026625836 7:71991229-71991251 CGGGCAGATCATCTGCAGTCAGG + Intronic
1027388229 7:77679408-77679430 CAGGTAGATCACCTGAAGTCAGG + Intergenic
1027396115 7:77756358-77756380 CAGGTAGATCACCTGAAGTCAGG - Intronic
1028599147 7:92582019-92582041 CAGGTGGAACACCTGAAGTCAGG + Intronic
1029253758 7:99255039-99255061 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1029577854 7:101415379-101415401 CGGGTAGATCATCTGAAGTCAGG - Intronic
1029706810 7:102280524-102280546 CGGGCAGAACTTCTGCAGTCTGG - Intronic
1030383137 7:108836120-108836142 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1031533104 7:122900082-122900104 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1031703503 7:124955434-124955456 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1032329336 7:130963085-130963107 CAGGTGGAACACCTGAAGTCAGG - Intergenic
1032591410 7:133195143-133195165 CAGATAGGCCATCTGCAAGCTGG - Intergenic
1033347342 7:140535807-140535829 CAGGTGGATCATCTGAAGTCAGG - Intronic
1033372582 7:140724234-140724256 GAGGTAGAACATGTGCAGCCTGG - Intronic
1033739921 7:144264486-144264508 TAGGCAGATCATCTGCAGTCAGG - Intergenic
1033775133 7:144601055-144601077 CAGGTAGATCACCTGAAGTCAGG + Intronic
1034110886 7:148536630-148536652 CAGGTAGATCATCTGAGGTCAGG + Intergenic
1034364956 7:150538279-150538301 CAGGCAGAACACCTGAAGTCAGG - Intergenic
1034993779 7:155565600-155565622 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1035694755 8:1586653-1586675 CACGTGGTACCTCTGCAGGCGGG - Intronic
1037786214 8:21904838-21904860 CAGGTGGATCACCTGAAGGCAGG + Intergenic
1038022925 8:23565008-23565030 CAAGTCCAAAATCTGCAGGCTGG + Intronic
1038473967 8:27849234-27849256 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1038558867 8:28551302-28551324 CAGGTGGATCACCTGCAGCCTGG + Intronic
1039121518 8:34152981-34153003 CGGGTAGATCACCTGAAGGCAGG + Intergenic
1039148951 8:34481255-34481277 CAGGAAGGACATCTTTAGGCAGG - Intergenic
1039529274 8:38245202-38245224 CAGGTAGATCATCTGAGGTCAGG + Intronic
1039773559 8:40713679-40713701 CAGGTAGATCACTTGCAGTCAGG + Intronic
1039937977 8:42064174-42064196 CAGGCAGAATACCTGCAGTCAGG + Intergenic
1040919954 8:52605077-52605099 AAGGTGGAAAATCTGCATGCAGG + Intergenic
1041102373 8:54409321-54409343 CAGGTGGATCATCTGAAGTCAGG + Intergenic
1041165719 8:55090552-55090574 CAGGTAGATCATCTGAAGTCAGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1042795715 8:72661241-72661263 CAGGTAGATCATCTGAGGTCAGG - Intronic
1043071508 8:75641782-75641804 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1044690588 8:94873511-94873533 CAGGAAGAACATATACAGGTAGG - Intronic
1044927892 8:97224641-97224663 CAGGTGGAGCAGCTGCAGGGAGG + Intergenic
1045130572 8:99147337-99147359 CAGGTAGATCATCTGAGGTCAGG - Intronic
1045281494 8:100753491-100753513 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1045666648 8:104494649-104494671 CAGGAAAAACATCTTCAAGCTGG - Intronic
1045692741 8:104776199-104776221 CAGGTAGATCATCTGAGGTCAGG - Intronic
1046748215 8:117898351-117898373 CATCTAGAACATCCCCAGGCTGG - Intronic
1048632638 8:136260671-136260693 CAACTAGAACATCTGCAGCAGGG + Intergenic
1052601359 9:30636633-30636655 CAGGGAGCACATGTGCAGGTTGG + Intergenic
1052666360 9:31499992-31500014 CAAGAAGAAAATCTGCAGCCTGG + Intergenic
1053044315 9:34901686-34901708 CAGGTAGATCATCTGATGTCAGG + Intergenic
1053606616 9:39666589-39666611 CGGGTAGATCATCTGAAGTCAGG + Intergenic
1054246923 9:62675821-62675843 CGGGTAGATCATCTGAAGTCAGG - Intergenic
1054561040 9:66710350-66710372 CGGGTAGATCATCTGAAGTCAGG - Intergenic
1056329665 9:85511037-85511059 CAGGAAGAACAGCTGCAGTATGG - Intergenic
1056814152 9:89789579-89789601 CAGGGAGTGCTTCTGCAGGCTGG + Intergenic
1056815998 9:89801444-89801466 CATTTATAACATCTGCAGACAGG + Intergenic
1056962487 9:91138520-91138542 CAGGTAGATCATCTGAGGTCAGG - Intergenic
1057452939 9:95181962-95181984 CAGGCAGCACATTCGCAGGCAGG + Intronic
1059279719 9:113122115-113122137 CAGGTGGATCATCTGAAGTCAGG - Intergenic
1060091517 9:120747499-120747521 CAGGTAGATTACCTGCAGTCAGG + Intergenic
1060503838 9:124182915-124182937 CAGCCAGCACTTCTGCAGGCTGG - Intergenic
1061327942 9:129875375-129875397 CACGTAGAACCGCAGCAGGCTGG - Exonic
1061790405 9:133056049-133056071 CTGGTAGAACATCTGCCGATAGG - Exonic
1185751432 X:2612894-2612916 CAGGCAGAACATCTGAGGTCAGG - Intergenic
1185944376 X:4358048-4358070 CAGGTGGATCATCTGCAGTCAGG + Intergenic
1187193057 X:17054929-17054951 CAGCCAGAATACCTGCAGGCAGG + Exonic
1187380368 X:18796181-18796203 CAGGTGGATCATCTGAAGTCAGG - Intronic
1187408625 X:19026721-19026743 CAGGTGGATCACCTGAAGGCAGG - Intronic
1187971718 X:24665516-24665538 CAGGTGGATCACCTGCAGTCAGG - Intronic
1188294125 X:28425248-28425270 CAGGGAGTACATGTGCAGGTTGG - Intergenic
1189074752 X:37904433-37904455 GAGGTAGAAAAACTGAAGGCTGG + Intronic
1190073792 X:47300689-47300711 CAGGTAGATCACCTGCAGTCAGG + Intergenic
1192549423 X:72042166-72042188 AAAGTAGAACATCTGGGGGCAGG - Intergenic
1193008151 X:76644060-76644082 CATGGAGAACCTCTGCTGGCAGG + Intergenic
1194044016 X:88979427-88979449 CAGTTTGAAAATCTTCAGGCAGG + Intergenic
1194189789 X:90820841-90820863 CAGCTAGAATATAAGCAGGCAGG + Intergenic
1195497739 X:105557161-105557183 AAGTTATAACATCTGCAGGATGG - Intronic
1198561533 X:137855887-137855909 CAGGTGGATCATCTGAAGTCAGG + Intergenic
1199079190 X:143557472-143557494 CAGGCAGATCACCTGAAGGCGGG + Intergenic
1200875403 Y:8149123-8149145 CAGGTGGATCATCTGGAGTCAGG - Intergenic
1202188664 Y:22217709-22217731 CAGGTGGATCATCTGGAGTCAGG - Intergenic