ID: 940972536

View in Genome Browser
Species Human (GRCh38)
Location 2:159909271-159909293
Sequence GGAATGCTTATGCACACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940972536_940972541 25 Left 940972536 2:159909271-159909293 CCATTGGTGTGCATAAGCATTCC No data
Right 940972541 2:159909319-159909341 TGGCATTGTAAAATTTTTGGTGG No data
940972536_940972543 27 Left 940972536 2:159909271-159909293 CCATTGGTGTGCATAAGCATTCC No data
Right 940972543 2:159909321-159909343 GCATTGTAAAATTTTTGGTGGGG No data
940972536_940972539 5 Left 940972536 2:159909271-159909293 CCATTGGTGTGCATAAGCATTCC No data
Right 940972539 2:159909299-159909321 CTGAACATCTTCATCAACATTGG No data
940972536_940972542 26 Left 940972536 2:159909271-159909293 CCATTGGTGTGCATAAGCATTCC No data
Right 940972542 2:159909320-159909342 GGCATTGTAAAATTTTTGGTGGG No data
940972536_940972540 22 Left 940972536 2:159909271-159909293 CCATTGGTGTGCATAAGCATTCC No data
Right 940972540 2:159909316-159909338 CATTGGCATTGTAAAATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940972536 Original CRISPR GGAATGCTTATGCACACCAA TGG (reversed) Intergenic
No off target data available for this crispr