ID: 940976967

View in Genome Browser
Species Human (GRCh38)
Location 2:159957213-159957235
Sequence CTGGGAAGAAGTAGAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940976960_940976967 15 Left 940976960 2:159957175-159957197 CCCAGTGGGACAGAAAGCAAGGG No data
Right 940976967 2:159957213-159957235 CTGGGAAGAAGTAGAAATGAAGG No data
940976962_940976967 14 Left 940976962 2:159957176-159957198 CCAGTGGGACAGAAAGCAAGGGT No data
Right 940976967 2:159957213-159957235 CTGGGAAGAAGTAGAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940976967 Original CRISPR CTGGGAAGAAGTAGAAATGA AGG Intronic
No off target data available for this crispr