ID: 940976967 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:159957213-159957235 |
| Sequence | CTGGGAAGAAGTAGAAATGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940976960_940976967 | 15 | Left | 940976960 | 2:159957175-159957197 | CCCAGTGGGACAGAAAGCAAGGG | No data | ||
| Right | 940976967 | 2:159957213-159957235 | CTGGGAAGAAGTAGAAATGAAGG | No data | ||||
| 940976962_940976967 | 14 | Left | 940976962 | 2:159957176-159957198 | CCAGTGGGACAGAAAGCAAGGGT | No data | ||
| Right | 940976967 | 2:159957213-159957235 | CTGGGAAGAAGTAGAAATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940976967 | Original CRISPR | CTGGGAAGAAGTAGAAATGA AGG | Intronic | ||
| No off target data available for this crispr | |||||