ID: 940983563

View in Genome Browser
Species Human (GRCh38)
Location 2:160029500-160029522
Sequence CTGCTTCCACAGCTTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940983558_940983563 7 Left 940983558 2:160029470-160029492 CCTAAGGCTGTGTGCAGTGCAAA No data
Right 940983563 2:160029500-160029522 CTGCTTCCACAGCTTGAGGTGGG No data
940983557_940983563 22 Left 940983557 2:160029455-160029477 CCTAGCAGGTTGGGACCTAAGGC No data
Right 940983563 2:160029500-160029522 CTGCTTCCACAGCTTGAGGTGGG No data
940983555_940983563 23 Left 940983555 2:160029454-160029476 CCCTAGCAGGTTGGGACCTAAGG No data
Right 940983563 2:160029500-160029522 CTGCTTCCACAGCTTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940983563 Original CRISPR CTGCTTCCACAGCTTGAGGT GGG Intronic
No off target data available for this crispr