ID: 940987439 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:160062945-160062967 |
| Sequence | GCTCCGCGACGCAGGCGCTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940987435_940987439 | -5 | Left | 940987435 | 2:160062927-160062949 | CCTAGAGTGAACCCAGCTGCTCC | No data | ||
| Right | 940987439 | 2:160062945-160062967 | GCTCCGCGACGCAGGCGCTTTGG | No data | ||||
| 940987434_940987439 | 16 | Left | 940987434 | 2:160062906-160062928 | CCGCGGATTTGCAGCGGGCAGCC | No data | ||
| Right | 940987439 | 2:160062945-160062967 | GCTCCGCGACGCAGGCGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940987439 | Original CRISPR | GCTCCGCGACGCAGGCGCTT TGG | Intergenic | ||