ID: 940987439

View in Genome Browser
Species Human (GRCh38)
Location 2:160062945-160062967
Sequence GCTCCGCGACGCAGGCGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940987435_940987439 -5 Left 940987435 2:160062927-160062949 CCTAGAGTGAACCCAGCTGCTCC No data
Right 940987439 2:160062945-160062967 GCTCCGCGACGCAGGCGCTTTGG No data
940987434_940987439 16 Left 940987434 2:160062906-160062928 CCGCGGATTTGCAGCGGGCAGCC No data
Right 940987439 2:160062945-160062967 GCTCCGCGACGCAGGCGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940987439 Original CRISPR GCTCCGCGACGCAGGCGCTT TGG Intergenic