ID: 940987797

View in Genome Browser
Species Human (GRCh38)
Location 2:160065738-160065760
Sequence GAGGCCCATCTCAAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940987797_940987802 13 Left 940987797 2:160065738-160065760 CCCCAAAATTTGAGATGGGCCTC No data
Right 940987802 2:160065774-160065796 AGTTTATTTTGCCAAGGTTGAGG 0: 414
1: 804
2: 870
3: 582
4: 535
940987797_940987801 7 Left 940987797 2:160065738-160065760 CCCCAAAATTTGAGATGGGCCTC No data
Right 940987801 2:160065768-160065790 TTAGAAAGTTTATTTTGCCAAGG 0: 642
1: 600
2: 376
3: 385
4: 736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940987797 Original CRISPR GAGGCCCATCTCAAATTTTG GGG (reversed) Intergenic
No off target data available for this crispr