ID: 940987797 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:160065738-160065760 |
Sequence | GAGGCCCATCTCAAATTTTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940987797_940987802 | 13 | Left | 940987797 | 2:160065738-160065760 | CCCCAAAATTTGAGATGGGCCTC | No data | ||
Right | 940987802 | 2:160065774-160065796 | AGTTTATTTTGCCAAGGTTGAGG | 0: 414 1: 804 2: 870 3: 582 4: 535 |
||||
940987797_940987801 | 7 | Left | 940987797 | 2:160065738-160065760 | CCCCAAAATTTGAGATGGGCCTC | No data | ||
Right | 940987801 | 2:160065768-160065790 | TTAGAAAGTTTATTTTGCCAAGG | 0: 642 1: 600 2: 376 3: 385 4: 736 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940987797 | Original CRISPR | GAGGCCCATCTCAAATTTTG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |