ID: 940992068

View in Genome Browser
Species Human (GRCh38)
Location 2:160107615-160107637
Sequence GAGGCTGGTGGAAGAGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 521}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940992068_940992071 -5 Left 940992068 2:160107615-160107637 CCTCAATCTCTTCCACCAGCCTC 0: 1
1: 0
2: 5
3: 38
4: 521
Right 940992071 2:160107633-160107655 GCCTCTTTCTCCCCTAGACAAGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940992068 Original CRISPR GAGGCTGGTGGAAGAGATTG AGG (reversed) Intronic
901079556 1:6576248-6576270 GAGGTTGGTGGGGAAGATTGAGG + Intronic
901453768 1:9351983-9352005 GAGGCTGGGGAAAGAGGGTGGGG - Intronic
901932363 1:12603622-12603644 GAGGCTGGTAGAAGTGGTTGGGG + Intronic
902097227 1:13956781-13956803 GAAGATGTGGGAAGAGATTGAGG + Intergenic
902304071 1:15524137-15524159 GCGGCTGGTGGAAGAGCTGCAGG - Exonic
903548434 1:24141495-24141517 GAGGCTGGTGGCTGAGGTGGGGG + Intronic
905627793 1:39499678-39499700 GAGGCTGGAGGAGGAGGCTGAGG + Intronic
905807481 1:40887290-40887312 GGGGGTGGTGGCAGAAATTGGGG + Intergenic
905987581 1:42300835-42300857 AAGTCAGCTGGAAGAGATTGGGG - Intronic
906143447 1:43546723-43546745 CAGGCTGGGGGATGAGAGTGAGG - Intronic
906477339 1:46178520-46178542 GAGGCTGGAGGAGGGGATGGGGG - Intronic
906535046 1:46546834-46546856 GAGGTTGGTGGAAGAGAATGAGG + Intronic
906545931 1:46619440-46619462 GAGGCAGGTGGAAGGGTTGGGGG + Intergenic
906648105 1:47490618-47490640 GTAGCTGGGGGCAGAGATTGTGG - Intergenic
907001016 1:50856257-50856279 GAGGCTGATGGAAGTTATTGGGG - Intronic
908999861 1:70205470-70205492 AAAGCAGGTGGAAGAGACTGCGG - Exonic
910788066 1:91021886-91021908 GAGGGTGGCGGAAGAACTTGGGG - Intronic
910849795 1:91638780-91638802 GAACCTGGAGGAAGAGGTTGTGG + Intergenic
911045410 1:93623575-93623597 GAAGCTGATGGAAGAGAATGTGG + Intronic
911080599 1:93925790-93925812 GTGGCTGGTGGGAGTGAGTGGGG + Intergenic
914342382 1:146771201-146771223 GAGGCTGCTGGAAGACTTGGTGG - Intergenic
914677170 1:149914158-149914180 GAGGCTTGTGGAAGAGAAGCAGG - Exonic
915141991 1:153773578-153773600 GAGACTGGGGGAGGAGATTGCGG - Exonic
915164265 1:153939873-153939895 GAGGCTGGAGGTGGAGATGGAGG - Intronic
915170890 1:153976731-153976753 CTGGCTGGTGGAAGAGTTTGTGG - Exonic
915758879 1:158290969-158290991 GAGGATGGTGGCAGAGCATGGGG + Intronic
916598668 1:166271455-166271477 GAAGCTGGAGGTGGAGATTGGGG - Intergenic
916824001 1:168426952-168426974 GTGGCTGGTGGCAGAGAGGGTGG + Intergenic
916944473 1:169712000-169712022 GAGGGTGGTGGAAAAGAAGGAGG - Intronic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
917594909 1:176519387-176519409 GGGGCTGGTGGAAGTGAAGGAGG + Intronic
917976569 1:180243655-180243677 GTAGCTGGGGGAGGAGATTGTGG + Intronic
919640121 1:200038832-200038854 GAGGCGGGGTGAAGAGGTTGGGG + Intronic
919973734 1:202597576-202597598 GAGGCTGGTAGAGTAGGTTGGGG + Intronic
920001899 1:202806817-202806839 GGGGGTGGGGGAAGAGAGTGGGG + Intronic
920162035 1:204005997-204006019 GGGACTGGTGGAAGGGAGTGGGG - Intergenic
920450974 1:206060878-206060900 GAAACTGGGGGCAGAGATTGGGG + Intronic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
922255077 1:223886648-223886670 GAGGCTGAGGTAAGAGATTAAGG - Intergenic
923717175 1:236434784-236434806 GTGGGTGGTGGAAGGTATTGGGG + Intronic
923781645 1:237030502-237030524 GAGGTTTGGGGAAGAGATTTGGG + Intergenic
924052682 1:240093237-240093259 GAGGCTGGGGGAAGAGCCGGAGG + Exonic
1062876314 10:945583-945605 GAGGCTGGGGCAGGAGAATGGGG + Intergenic
1063453646 10:6168191-6168213 GAGGCTGGTGGAAGATCATGAGG + Intronic
1064034900 10:11907325-11907347 GAAGCTGGTTGAAGGGTTTGTGG + Intergenic
1064479278 10:15723103-15723125 GAGGCTGGTGGATCATCTTGAGG + Intergenic
1064598806 10:16972759-16972781 GGGGCTGGTGATAGAGATGGTGG - Intronic
1064799011 10:19047414-19047436 CAGGATTGTAGAAGAGATTGAGG + Intergenic
1065116951 10:22492505-22492527 CAAGCTGGTGGAGGAGATGGAGG - Intergenic
1065473574 10:26109850-26109872 GAAACTGGTGAAAGAGTTTGAGG + Intronic
1065945554 10:30602721-30602743 GAGGCTGATGTGAGAGTTTGAGG + Intergenic
1066616367 10:37299117-37299139 GAGGATGGTGGCAAAGAGTGAGG - Intronic
1069003435 10:63291709-63291731 GAGGCTGAGGCAAGAGTTTGAGG - Intronic
1069291478 10:66785872-66785894 GGGGTTGGGGGAAGAGAGTGTGG - Intronic
1069682026 10:70292073-70292095 GAGGCTGGTTAAGGAGATGGAGG - Intergenic
1070391625 10:75975889-75975911 GGTGGTGGTGGAAGAGATTCAGG - Intronic
1070911567 10:80123430-80123452 GGGACTGGGGGAAGAGAGTGTGG + Intergenic
1071516296 10:86300137-86300159 GAGGATGGTGGCAGAAAATGGGG + Intronic
1071801799 10:89071521-89071543 GAGGCTGATGGAGGAGATTGTGG - Intergenic
1072526613 10:96277246-96277268 GAGGCATGGGGATGAGATTGGGG - Intergenic
1072598430 10:96898528-96898550 GATTCTGGTGGTAGAGATGGTGG + Intronic
1074426182 10:113353555-113353577 GAAGCTGAAGGCAGAGATTGGGG + Intergenic
1074601528 10:114918604-114918626 GAGTCTGGTGGGAGAAATTCAGG + Intergenic
1075331557 10:121577858-121577880 GAGGCTGGTGGAGGAGGAGGAGG - Intronic
1076117976 10:127913858-127913880 AAGGCTGGTGGATGAGGTGGGGG - Intronic
1076212949 10:128664945-128664967 GAGGCTGGGGGATGGGAATGGGG + Intergenic
1076610291 10:131722159-131722181 GAGGCTCATGGAAGAGATCTAGG + Intergenic
1076649267 10:131976625-131976647 GAGTCTGGTTGCAGAGAGTGTGG - Intronic
1077139457 11:1017494-1017516 GATGCTGGTGGTAGAAGTTGAGG + Exonic
1077776802 11:5280959-5280981 GAGGATGCTGGAAGGGATAGAGG + Intronic
1077940372 11:6834394-6834416 GATGCTGGTGGAGAGGATTGTGG - Intergenic
1078700036 11:13670811-13670833 GAGGCTGGAGGCAGAGACTGAGG + Intronic
1079351964 11:19699369-19699391 GAGGCTGGTGGCAGCATTTGGGG - Intronic
1079615617 11:22488979-22489001 GTAGATGCTGGAAGAGATTGAGG + Intergenic
1079662753 11:23061153-23061175 GAGACTTTTGGAAGAGACTGTGG + Intergenic
1080265742 11:30400160-30400182 GAGGCTGATGCAGGAGCTTGAGG - Intronic
1080299443 11:30767950-30767972 GAGGCAGGAGGCAGAGGTTGTGG + Intergenic
1080416013 11:32070547-32070569 GAGGGAGGAGGAAGAGGTTGGGG + Intronic
1080596328 11:33777089-33777111 GAGGCATGTGGTAGAGGTTGGGG + Intergenic
1080649049 11:34208684-34208706 GGGGCTGGTGGAAGAGGAGGTGG - Intronic
1080868454 11:36215423-36215445 GAGGCAGGTGGAAGGGACAGTGG + Intronic
1080957309 11:37114390-37114412 GAGGCTGGGGGCAGTGTTTGTGG + Intergenic
1081092962 11:38895825-38895847 GAGACTGTTGGTAGAGACTGCGG - Intergenic
1081265870 11:41020534-41020556 GAAGATGGTAGCAGAGATTGAGG + Intronic
1081606619 11:44531208-44531230 GAGGCGGGTGGTAGAGATGAGGG - Intergenic
1082096811 11:48137701-48137723 GAGGCTGGAGGAAGAGCAGGAGG + Intronic
1083200524 11:61118568-61118590 CAGGCTGGTGGAAGGGGTGGGGG + Intronic
1083424968 11:62578795-62578817 GAAGCTGGAGGCAGAGACTGGGG + Exonic
1083663166 11:64261484-64261506 GAGGCTGCTCGAAGTGAGTGGGG + Exonic
1083961792 11:66018689-66018711 GAGGCTTGTGGATGAGCCTGTGG - Intronic
1085015238 11:73169684-73169706 GAGGATGCTTGAAGAGACTGCGG + Intergenic
1085132552 11:74053878-74053900 GAGGCTGAGGCAGGAGATTGCGG + Intronic
1085497702 11:76986831-76986853 GAGGCTGGTGGATCACCTTGAGG + Intronic
1085836613 11:79963378-79963400 GAGGATGGTGGTAGGGATGGAGG - Intergenic
1086502155 11:87464562-87464584 AAGGATGGGGGAAGAGAATGAGG + Intergenic
1087226839 11:95610674-95610696 GAGCCTGGAGGCAGAGGTTGTGG + Intergenic
1089854506 11:121531159-121531181 GAGGCAGGTGGAAGCACTTGAGG + Intronic
1090053884 11:123405115-123405137 GAAGTTGGGGGAAGAGATGGTGG + Intergenic
1090284716 11:125489738-125489760 GAGTCTGGATGAAGAGTTTGAGG - Exonic
1090552825 11:127841568-127841590 GAGGGAGGAGGAAGAGAGTGGGG - Intergenic
1091803286 12:3338686-3338708 TAGGGTGGTGGAAGAGATATAGG + Intergenic
1092920225 12:13224474-13224496 GAAGCTGGAGGAAGAATTTGAGG + Intergenic
1094057220 12:26279778-26279800 GAGGCAGGTGGTAGGGGTTGGGG - Intronic
1095316440 12:40767409-40767431 GAGGCTGGGGCAGGAGAATGGGG - Intronic
1095980261 12:47969032-47969054 GAGGCAGATGGAAGAAAATGAGG - Intergenic
1096228295 12:49883161-49883183 CAGGCTGTGGGAAGCGATTGCGG + Intronic
1096609527 12:52791705-52791727 GAGGCTGCGGGCAGAGATCGAGG - Exonic
1096983448 12:55742426-55742448 GAGGCAGGTGCAGGGGATTGGGG - Intergenic
1098216387 12:68224678-68224700 GAGGGTGGAGGAAGAGAAAGGGG + Intronic
1099431575 12:82592356-82592378 GAGGATGGGGGAACAGATTTTGG - Intergenic
1102450414 12:113037792-113037814 GAGGCAGGTAGAAGACAGTGAGG - Intergenic
1105730463 13:23210586-23210608 GAGGCTGAAGCAAGAGAATGCGG + Intronic
1106274419 13:28190426-28190448 GGGGGTGGGGGTAGAGATTGGGG + Intronic
1106578729 13:30999779-30999801 GAGGCAGGTGGAAGGCAGTGGGG + Intergenic
1108475105 13:50808301-50808323 GAGGCAGCTGAAAGAAATTGGGG + Intronic
1108872167 13:55001071-55001093 GAGGCTGGTGCAAGTGCTTTTGG - Intergenic
1110554669 13:76844976-76844998 GAGGCTGGAGGATGGGAATGGGG + Intergenic
1110999333 13:82158397-82158419 GAGGCAGGAGGAAGAGATGAGGG - Intergenic
1112195933 13:97226253-97226275 GAGGCTGATGGACGAGTTTTGGG + Intronic
1113279509 13:108773503-108773525 GAGGATGAAGGCAGAGATTGGGG - Intronic
1113568641 13:111337838-111337860 GAGGCTGGAGGAAGGGAGCGAGG - Intronic
1114180395 14:20362262-20362284 GTGGCTGGAGGAAGAGAGAGGGG + Intergenic
1114327011 14:21599729-21599751 GAGGCTGGGAGGAGAGCTTGAGG - Intergenic
1114408604 14:22479384-22479406 GGGACTGGTGGAAGAGTTTACGG - Intergenic
1114493458 14:23117531-23117553 GAATCTGGCGGAAGAGGTTGCGG + Exonic
1115147729 14:30245213-30245235 GAGGTTGGCAGAAGAGGTTGTGG - Intergenic
1116648188 14:47557002-47557024 GAGGCTAGTGTCAGAGAGTGTGG - Intronic
1116871299 14:50071151-50071173 GACGATGGAGGCAGAGATTGGGG - Intergenic
1117016321 14:51521091-51521113 GGGGCTGGGGGAAGTGATTATGG + Intronic
1119220309 14:72901086-72901108 GAGGAGGGTGGAAGAGAGAGAGG - Intergenic
1119719058 14:76878968-76878990 GACACTGGTGGAATAGATTTGGG + Intergenic
1120372319 14:83651832-83651854 CAGGCTGGTGGAGAAGAATGAGG + Intergenic
1120543098 14:85776008-85776030 GAGACTGGAGTAAGAGTTTGAGG - Intergenic
1121625771 14:95384555-95384577 GGGGCTGATGGAAGAAAATGGGG - Intergenic
1121835312 14:97086994-97087016 CAGTCTGGTGGAAAAGATGGAGG - Intergenic
1121857806 14:97286297-97286319 GAAGATGGAGGCAGAGATTGGGG + Intergenic
1121911783 14:97798477-97798499 GAGGCTGTGGGAGGAGGTTGGGG - Intergenic
1122321511 14:100858596-100858618 GAGGCGGGTGGAAGAGAGCCGGG - Intergenic
1122804224 14:104248486-104248508 GAGGGTGGTGCATGAGTTTGCGG + Intergenic
1122817820 14:104322172-104322194 AAGACTGGAGGAAGAGATGGGGG - Intergenic
1123720291 15:23054993-23055015 GAGGATGGAGAAAGAGATTTGGG - Intergenic
1123773060 15:23548549-23548571 GAGGCTGGAGGAAATGCTTGAGG - Intergenic
1127025801 15:54804886-54804908 AAGGGTGGTGGTAGAGAATGGGG - Intergenic
1127224260 15:56913883-56913905 CTGGCTGGTGGAAAAGAATGCGG + Intronic
1127473410 15:59310483-59310505 GATGATGGAGGCAGAGATTGGGG + Intronic
1127921215 15:63495838-63495860 GAGGCTGGGAGAAGAGAGAGAGG - Intergenic
1127940340 15:63688881-63688903 GGGGCTGGGGGAAGGGTTTGAGG + Intronic
1127988130 15:64090963-64090985 GAGGCTGGAGAAAGAGATGAAGG + Intronic
1128029793 15:64469795-64469817 GAGGCGGGTGGATCAGCTTGAGG + Intronic
1129294470 15:74592331-74592353 GTGGCTTGAGGAAGAGAATGTGG - Intronic
1130259578 15:82344770-82344792 GAGGCTGCTGGACGAGGTGGAGG - Exonic
1130269104 15:82434416-82434438 GAGGCTGCTGGACGAGGTGGAGG + Exonic
1130281683 15:82524395-82524417 GAGGCTGCTGGACGAGGTGGAGG + Intergenic
1130342695 15:83012577-83012599 AAGGCTGGTGATAGAGATTCTGG + Intergenic
1130359909 15:83173703-83173725 GAGGCTAGAGGTAGAGATTTGGG - Intronic
1130371148 15:83285664-83285686 AAGGCAGGTGGAAGAAACTGAGG - Intergenic
1130473052 15:84240557-84240579 GAGGCTGCTGGACGAGGTGGAGG + Exonic
1130480466 15:84354622-84354644 GAGGCTGCTGGACGAGGTGGAGG + Intergenic
1130491245 15:84433137-84433159 GAGGCTGCTGGACGAGGTGGAGG - Intergenic
1130502828 15:84511937-84511959 GAGGCTGCTGGACGAGGTGGAGG - Intergenic
1130595341 15:85245165-85245187 GAGGCTGCTGGACGAGGTGGAGG + Intergenic
1130633071 15:85588779-85588801 AAGGCAGCTGGAAGAGTTTGAGG + Intronic
1131829911 15:96347582-96347604 GAGGCTGGTGGAGGGGCTGGCGG - Intergenic
1131960876 15:97789069-97789091 GTGGCTGTTGGAAGAGGCTGTGG + Intergenic
1132019914 15:98351899-98351921 CAGGCTGGTGGCAGATATGGAGG + Intergenic
1132907723 16:2291707-2291729 GAGGCTGGAGGAACAGCCTGGGG - Intronic
1133542029 16:6765208-6765230 AAGGCTGGAGGAACAGAATGAGG + Intronic
1134103023 16:11465803-11465825 GAGACTGGTAGAAGACATGGGGG + Intronic
1134761136 16:16716302-16716324 GAGGCAGGAGGAATAGAGTGGGG - Intergenic
1134984923 16:18642874-18642896 GAGGCAGGAGGAATAGAGTGGGG + Intergenic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1137606381 16:49789453-49789475 GGGGCTGGTGGAAGAGTTGCAGG - Intronic
1137650338 16:50114601-50114623 GAAGCTTGAGGAAGAGAATGTGG + Intergenic
1138341152 16:56289867-56289889 GAGGCTGGTGCAATTGTTTGGGG - Intronic
1138363209 16:56450912-56450934 GAGGCTGGAGGATGAGAAAGGGG + Intronic
1138428979 16:56955794-56955816 GAGGCTGGAGGAAGAGAGAACGG - Intergenic
1139100379 16:63759897-63759919 GAGGCTGAGGCAAGAGAATGGGG + Intergenic
1139715754 16:68811744-68811766 GAGGATGGTGTAAGCGATGGCGG - Exonic
1139991892 16:70946219-70946241 GAGGCTGCTGGAAGACTTGGTGG + Intronic
1140380052 16:74478813-74478835 GAGGCAGGAGGCGGAGATTGTGG + Intronic
1140824604 16:78694133-78694155 GAGGCAGGAGGCAGAGGTTGCGG + Intronic
1140909428 16:79438118-79438140 GGGGCAGGGGGAAGAGAGTGGGG + Intergenic
1141899828 16:86983877-86983899 GAGGCTGGAGGTAGAACTTGAGG + Intergenic
1141987459 16:87589184-87589206 GTGGCTGATGGCAGAGATTCAGG + Intergenic
1143096137 17:4479482-4479504 GAGGCTGGACGAAGAGCATGGGG - Intronic
1143112872 17:4562599-4562621 GAGGCTGGGGCAGGAGATGGGGG - Intergenic
1146062789 17:29615818-29615840 GACGCTGCTGGAAGAGATCAAGG - Exonic
1146442354 17:32908128-32908150 GAAGCTGGAGGAAAAGACTGGGG + Intergenic
1146714522 17:35073477-35073499 AAGACTGGTGGGAGAGATGGTGG + Intronic
1146714579 17:35074244-35074266 AAGACTGGTGGGAGAGATGGTGG - Intronic
1146939130 17:36831929-36831951 GAGGCTGGTGGATTAGATGAAGG + Intergenic
1146957347 17:36943223-36943245 GAGGCTGGAGGAAGGGGGTGGGG - Exonic
1147322236 17:39653325-39653347 CAGGCTGGTGGAGGACATTTGGG + Intronic
1147747327 17:42702805-42702827 GTGGCTGTTGGAATAGATTTGGG - Intronic
1147970840 17:44218722-44218744 GAGGCGGGAGGAGGAGACTGGGG - Intronic
1148083905 17:44982723-44982745 GATGGTGGTGGTAGAGATGGTGG + Intergenic
1148483674 17:47976775-47976797 GAGGCTGCTGGAATCGACTGGGG + Exonic
1148759047 17:49989962-49989984 GAGGCTGGTGGCAGCTCTTGTGG - Intergenic
1148790076 17:50167988-50168010 GAGGCTGGTGCTGGAGATTGGGG + Exonic
1149575066 17:57706012-57706034 GAGGCTGGAGGCAGAAACTGGGG + Intergenic
1151434571 17:74086964-74086986 GGGGATGCTGGAAGAGAGTGTGG - Intergenic
1151541558 17:74767387-74767409 GAGGCCCGGGGAAGAGATGGTGG + Intronic
1151684681 17:75639645-75639667 TGGGCTGGTGGGAGAGGTTGGGG + Exonic
1151966089 17:77432548-77432570 GGGGCTGGTGGAACAGCCTGAGG - Intronic
1152460681 17:80440736-80440758 GAAGCTGGTGGGAGAGTGTGGGG - Intergenic
1153091476 18:1350253-1350275 TAGGCTGATGGAAGTGAATGAGG + Intergenic
1154491733 18:14927475-14927497 GAAGGTGTTGGAAGAGATTAAGG - Intergenic
1155156456 18:23161817-23161839 GAGGCTGCGGCAAGAGAATGGGG + Intronic
1156472709 18:37387640-37387662 GAGGCTGGTGGAAGAGTCCAGGG + Intronic
1156986943 18:43360138-43360160 GAGCCTGGTGGAAGATGTTTGGG - Intergenic
1157888596 18:51392759-51392781 GAGGCTGAGGCAAGAGAATGGGG + Intergenic
1158266897 18:55669238-55669260 GAGGCTGATGGGAGAGAATGGGG + Intergenic
1159819431 18:73120992-73121014 AAGGTTGGTGGAAGATTTTGGGG - Intergenic
1159902877 18:74064562-74064584 GAGGCAGGTGAAAGAGGCTGAGG + Intergenic
1160803866 19:982908-982930 GAGGCTGGTGCCAGAGCGTGCGG - Intergenic
1160851596 19:1195452-1195474 CAGCCTGGAGGAAGAGATGGAGG + Intronic
1160852020 19:1197266-1197288 CAGCCTGGAGGAAGAGATGGAGG + Intronic
1160939954 19:1615561-1615583 GAGGTTGGGGGAAGAGCGTGGGG + Intronic
1160942488 19:1626963-1626985 GAGGCTGGGGGAGGATGTTGGGG - Intronic
1161268268 19:3375197-3375219 GAGGCTGCTGGAAGGGACAGGGG - Intronic
1161458283 19:4381039-4381061 GAGGCTGGGGGAACAGAGAGAGG - Intronic
1161482935 19:4519726-4519748 CTGGCTGGTAGAAGAGGTTGGGG - Intergenic
1161492052 19:4567541-4567563 GAGGCTGGTGGAATGGGGTGTGG - Intergenic
1162630459 19:11923563-11923585 CAGGCTGGTGGGAGAGAGGGTGG - Intergenic
1162933270 19:13967707-13967729 GAGGCTGGAGGAATCGCTTGAGG - Intronic
1163100050 19:15090045-15090067 GAAGATGGAGGCAGAGATTGGGG + Intergenic
1163833499 19:19559267-19559289 GAGGCTGGGGAAAGGGAATGAGG + Intergenic
1164596015 19:29530977-29530999 GAGGCTGGGAGAAGGGATTGGGG + Intronic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165763616 19:38336638-38336660 GAGGGTGGGGCAAGAGGTTGGGG + Intronic
1165855864 19:38879024-38879046 GAGGGAGCTGTAAGAGATTGGGG + Exonic
1165858693 19:38895205-38895227 GAGGCTGGGGGAGGAGGCTGGGG - Intronic
1166382783 19:42363343-42363365 GAGGAGGGTGGAGGAGATGGTGG - Intronic
1166407813 19:42534011-42534033 GAGGCTGAGGCAAGAGAATGGGG + Intronic
1166718887 19:44986404-44986426 GAGGCAGGTGGAAGTGCTCGGGG - Intronic
1166884942 19:45954493-45954515 GAGGATGGGGGAAGAGCTGGGGG + Intronic
1167004475 19:46766705-46766727 GAGGCTGGAGTAAGAGAGGGAGG + Intronic
1167430270 19:49450167-49450189 GAGCCAGGTGGAAGAGACTGCGG - Intronic
1167524214 19:49973476-49973498 GAGTCTGTTGGGAGAGATGGAGG - Intergenic
1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG + Intergenic
1168507327 19:56947293-56947315 GGGGCAGGAGGAAGAGATGGGGG + Intergenic
1168545248 19:57244594-57244616 GAAGCTGGTGGAAGGAAATGGGG + Intronic
925440822 2:3883696-3883718 GAGGCACGTGGAGGAGCTTGTGG + Intergenic
925519483 2:4726022-4726044 GAGGTTGGTGGGAGGGACTGGGG + Intergenic
925572171 2:5324365-5324387 GAAGAAGGTGGAAGAGAATGAGG - Intergenic
925618975 2:5771971-5771993 GCTGCTGGTTGAGGAGATTGAGG + Intergenic
925744356 2:7031934-7031956 CAGGCAGGTGGAAGTGACTGTGG + Intronic
925813072 2:7720294-7720316 GATCATGGTGGAAGAGATTCAGG + Intergenic
926121730 2:10244964-10244986 GCTGCTGTTGGAAGAGATGGGGG + Intergenic
926403050 2:12519669-12519691 GAAGCTGCTGGAAGATAATGAGG + Intergenic
926425946 2:12738713-12738735 GAGGCTGGTCTAGGAGCTTGGGG + Intronic
927995195 2:27480164-27480186 GTGGCTTTTAGAAGAGATTGAGG + Intronic
928143319 2:28749843-28749865 GAGGCTCATGGAAGAGATTTGGG + Intergenic
928144684 2:28762050-28762072 GAGGCGGGTGGAATTGCTTGAGG + Intronic
929512034 2:42572174-42572196 GAGGCTGGGGCAGGAGAATGGGG + Intronic
930037529 2:47096331-47096353 GAGGCTGGTGGAAGGGTTTGTGG + Intronic
931077355 2:58730915-58730937 GAGGCTGATGGGAGAGATAAGGG - Intergenic
931758907 2:65399189-65399211 GAAGCTGGAGGCAGAGGTTGCGG + Intronic
932073943 2:68645856-68645878 GAAGCTGGTGGAAGTGTTGGTGG - Exonic
932422791 2:71611508-71611530 GAGGCTGGGGGAGGAGATGTTGG - Exonic
932573250 2:72949405-72949427 GAGGCTGAGGCAAGAGTTTGAGG - Intronic
933124739 2:78590512-78590534 GAAGATGGAGGCAGAGATTGGGG + Intergenic
933401476 2:81803004-81803026 GGGGCTGGGGGAAGGGAATGAGG - Intergenic
933754564 2:85627732-85627754 GAGGCTGTTGGAGAAGTTTGAGG + Intronic
934924752 2:98374488-98374510 GTGGCTGGTGGAAGGGCCTGGGG - Intronic
935157634 2:100497282-100497304 GAGGGTGGTGGAGGAGAGGGAGG - Intergenic
935608190 2:104991721-104991743 GAGGCTGGTGGAGGAGGATGTGG - Intergenic
935922156 2:108027865-108027887 GAGGCTGGGGGAAGGACTTGGGG - Intergenic
937160841 2:119759818-119759840 GAGGGAGGAGGAAGAGATAGAGG + Exonic
937770919 2:125720515-125720537 GAGGCAGGAGGCAGAGATAGAGG + Intergenic
937866905 2:126759333-126759355 GAGGCTGAAGAAAGAGCTTGTGG + Intergenic
939079935 2:137647562-137647584 GAAGTTGGTGGAAGAGCTAGAGG - Intronic
939302818 2:140368465-140368487 AATACTGGTGGAAAAGATTGGGG - Intronic
939532515 2:143382145-143382167 GAGGCTGGTGGAAGGAAGGGAGG - Intronic
939588604 2:144035063-144035085 GAGCCTGGTGGAAGATGTTTGGG + Intronic
940992068 2:160107615-160107637 GAGGCTGGTGGAAGAGATTGAGG - Intronic
942326461 2:174780707-174780729 GAGGCTGGTGCAAGATTTGGAGG + Intergenic
942704517 2:178755072-178755094 GAAGCTGGTGGAATAAATTCAGG - Intronic
947673306 2:231955846-231955868 GAGCCTGGAGGCAGAGGTTGTGG - Intergenic
947782670 2:232783762-232783784 GAAGCGGGTGGCAGAGGTTGCGG - Intronic
947921973 2:233884663-233884685 GAGGCAGGTGGAATTGCTTGAGG - Intergenic
948183255 2:235999616-235999638 GATGATGGTGGTAGTGATTGTGG + Intronic
948892895 2:240915839-240915861 GGGGCAGGAGGAAGAGATAGGGG + Intergenic
1169130333 20:3163524-3163546 GAGGCTGGGGGAATAGAGTGCGG + Exonic
1169563379 20:6826267-6826289 GAGGTTGGTGGAAGAGGATTTGG + Intergenic
1169740088 20:8882940-8882962 AAGTCTTGTGGAAGAGATTTGGG - Exonic
1169819352 20:9691316-9691338 GACGGTGGTGGGAGAGAGTGAGG + Intronic
1170626172 20:18031718-18031740 GTGGCTGGTGGAGGAGAGGGGGG + Intronic
1170773706 20:19357155-19357177 GAAGGTGGAGGCAGAGATTGGGG + Intronic
1171123357 20:22583481-22583503 TATGCTGGTGGGAGAGTTTGGGG - Intronic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1171369351 20:24651352-24651374 GGGGATGATGCAAGAGATTGTGG + Intronic
1171377886 20:24707217-24707239 GAGGCTGGGGCAGGAGAATGGGG - Intergenic
1171937152 20:31285952-31285974 GAGGCTGCTGGAATCGACTGGGG - Intergenic
1172285664 20:33738672-33738694 GAAGGTGGTAGAAGAGATAGAGG + Intronic
1172706986 20:36889178-36889200 GATGCTGGTGGCAGAGCCTGGGG + Intronic
1172745417 20:37203939-37203961 GAGCATCGTGGAGGAGATTGAGG + Exonic
1172925052 20:38526364-38526386 GAGGCGGGAGGAAGAGAAAGAGG - Intronic
1172938596 20:38638992-38639014 GAGCATGGTGGCAGAGAGTGTGG + Intronic
1173233865 20:41225915-41225937 GGGGCTGGGGGAAGAGAGTAAGG - Intronic
1173243217 20:41316784-41316806 AAGCCTGTTGGAAGTGATTGAGG - Intronic
1173257592 20:41405781-41405803 GAAGCTGGCAGAAGAGAGTGGGG + Intronic
1173531296 20:43771772-43771794 TAGGCTGGGGGAAGAGGGTGTGG + Intergenic
1174265438 20:49328474-49328496 GAGACTGCTGGAAGAGAAGGTGG - Intergenic
1175127227 20:56761538-56761560 GATGATGGTGGTAGAGATGGTGG + Intergenic
1175132826 20:56802421-56802443 CAGGCTGGTGGCAGGGATTAAGG - Intergenic
1175956141 20:62610350-62610372 GGGGCAGATGGAACAGATTGGGG + Intergenic
1175983609 20:62753482-62753504 GTGGCTGGTGGCTGTGATTGCGG - Intronic
1176932131 21:14826407-14826429 GAGGGTGGTGGCAGAAATGGTGG - Intergenic
1177749093 21:25257257-25257279 GAGGCTGAGGCAAGAGAATGGGG + Intergenic
1177800880 21:25827441-25827463 GAGAATGGTGGATGAGATTTAGG + Intergenic
1178660741 21:34505517-34505539 GAGGCTGGAGGGAGAGTGTGAGG + Intergenic
1179025066 21:37673189-37673211 GAGGCTGGAGGAAGAGGGTTGGG + Intronic
1179081888 21:38179009-38179031 GGGGGTGGTAGTAGAGATTGTGG - Intronic
1179904390 21:44414728-44414750 GTGGCTGGTGGAAGAAAAGGGGG + Intronic
1180666731 22:17519183-17519205 GAGGCTGGTGGTGGGGAGTGGGG + Intronic
1181004129 22:20001712-20001734 GAGGCAGGAGGCAGAGGTTGTGG + Intronic
1181610073 22:24006301-24006323 GAGGCTGGAGTATGAGCTTGTGG + Intergenic
1181970814 22:26688491-26688513 GAGGCTGTTGAAAGATAATGAGG + Intergenic
1182051463 22:27315822-27315844 GAGGCTGGTCACAGACATTGGGG - Intergenic
1182059480 22:27386794-27386816 GGGGCAGGTGGCAGAGAATGAGG - Intergenic
1182358026 22:29731020-29731042 GGGGCAGGTGGAGGAGAGTGAGG + Exonic
1182755741 22:32677420-32677442 GGGACTGGTGGAATAAATTGTGG + Intronic
1182894995 22:33851829-33851851 GAGGCAGGAGGAACAGAATGAGG + Intronic
1183776364 22:39968789-39968811 GAGGCTGGGGAAATAGATTCTGG - Intronic
1184155734 22:42665590-42665612 GTGGCTGATGGAGGAGAGTGGGG + Intergenic
949825087 3:8156706-8156728 GAGGTTTGTGGAAGGGAATGAGG - Intergenic
949919087 3:8987442-8987464 GAGTCTGGTGAAACAGATGGTGG + Intronic
950552575 3:13675573-13675595 GAGGCTGCTGGCAGAGCTGGAGG - Intergenic
950557128 3:13702628-13702650 GGGGCAGGTGGAAGGGACTGAGG + Intergenic
952175539 3:30858723-30858745 GAGGCTCTTGCAAAAGATTGAGG + Intronic
952341942 3:32454433-32454455 AAGGCTGGAGGAAGAGTTTCCGG - Exonic
952832829 3:37579314-37579336 GAGGATGGTGGAACAGAAAGAGG - Intronic
952851427 3:37732836-37732858 GTGGCTGGTGGAAGGGCTGGGGG - Intronic
952918037 3:38264329-38264351 GATCCTGGTGGGAGAGGTTGGGG + Intergenic
953381688 3:42477157-42477179 CAGGGTGGTGGAGGAGAGTGAGG - Intergenic
953439782 3:42907393-42907415 GTGGCTGGTGGCAGTGACTGGGG + Intronic
954148324 3:48645301-48645323 GATGCTGGGGTAAGATATTGTGG - Intronic
954539180 3:51382441-51382463 GAGACTGGTGTAAGAGTGTGGGG + Exonic
955101037 3:55850113-55850135 GAAGTTGGAGGCAGAGATTGTGG - Intronic
957036837 3:75301434-75301456 GAAGCTGGTGGAAGATATTTGGG - Intergenic
957785070 3:84871897-84871919 AAGGCTGGTGGAAAAGTCTGAGG - Intergenic
958023885 3:88028042-88028064 AAGGCTTGTGGATGACATTGTGG - Intergenic
959482000 3:106885120-106885142 CAGGCTGGTGGCATTGATTGTGG + Intergenic
959676621 3:109042914-109042936 GAGGCTGGGGGAGGGGGTTGGGG + Intronic
961080586 3:124023905-124023927 GAAGCTGGTGGAAGATATTTGGG - Intergenic
961583373 3:127901982-127902004 GAGGCTGCTGTAACAGATTTGGG + Intergenic
961981563 3:131084603-131084625 GAGGGTGGTGGTAGTGGTTGTGG + Intronic
962018243 3:131466991-131467013 GAGGCTGGGGGAAAATAGTGGGG - Intronic
962284593 3:134075516-134075538 GATGCTGATGGATGAGATAGGGG - Intronic
962421900 3:135236257-135236279 GAAGATGGAGGCAGAGATTGGGG - Intronic
962962385 3:140322408-140322430 GATGCTGGTGGGGGAGATGGAGG + Intronic
963590839 3:147256368-147256390 GAGGCTGATGGAGGAGCTAGAGG + Intergenic
964432184 3:156619012-156619034 GAGGCTGAGGCAAGAGAATGAGG - Intergenic
964757482 3:160101653-160101675 GAGGCTGCTGGCAGAGAGAGAGG + Intergenic
966428882 3:179810473-179810495 GAGGCCAGTGGAATAGAATGAGG - Intronic
967258556 3:187619027-187619049 GTGGTTGGTGGAAGAGTTAGAGG - Intergenic
967407983 3:189138566-189138588 GAGGTTGGAGAAAGAGAATGAGG + Intronic
967943835 3:194786853-194786875 CAGTCTAGTGGAGGAGATTGCGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969569902 4:8002158-8002180 CAGGCTGGAGGCAGAGACTGAGG - Intronic
969599961 4:8170507-8170529 GTGGCTGGTGGAGGAGATGGTGG + Intergenic
970578512 4:17451453-17451475 GTGGCTGGTGCAAGTGGTTGGGG - Intergenic
971001403 4:22326890-22326912 GAAGCTGGTGTATGAGATTGAGG + Intergenic
971470871 4:27025046-27025068 GAGGCTGGCCAAAGAGACTGTGG + Intronic
975336573 4:73183574-73183596 GAGGCTGAAGGAAGAGAAGGAGG - Intronic
976615981 4:87077562-87077584 GAGGCTGGGGGAAGGAATAGGGG - Intronic
977942546 4:102874545-102874567 GAAGATGGAGGCAGAGATTGGGG + Intronic
978024685 4:103858568-103858590 GAGATTTGTGGAAAAGATTGAGG - Intergenic
978053930 4:104239351-104239373 GAGGCTGAGGGAGGAGAATGGGG + Intergenic
978083609 4:104623157-104623179 AAGCATGGTGGAAGAGATGGAGG + Intergenic
978488620 4:109285982-109286004 GAGGCTGGTGGAATAGAAGTAGG + Intronic
980203817 4:129691712-129691734 GTGGCAGGTGAAAGAGAGTGAGG + Intergenic
981036080 4:140169995-140170017 GAGGCTGGTGTAAGGGCTGGGGG + Intergenic
981422966 4:144572286-144572308 GTAGCTGGAGGCAGAGATTGAGG + Intergenic
982015322 4:151147692-151147714 GAGGCTGGTGGATCAGCTTGAGG - Intronic
982357768 4:154489412-154489434 CAGGCAGGTGGCAGAGAGTGGGG + Intronic
982456222 4:155612085-155612107 AATTCTGGTGGAATAGATTGGGG - Intergenic
982474877 4:155837919-155837941 GAGGCTGGAGGGAGAGCTTGGGG - Intronic
983803810 4:171968424-171968446 GAAGATGGAGGAAGAGATTACGG - Intronic
983994841 4:174169266-174169288 GAGGCTGGTGAAACTGACTGGGG - Intergenic
984121120 4:175745809-175745831 GAGGCTGGAGAAGGAGATGGGGG + Intronic
984530936 4:180915440-180915462 GAGCCTGGTGGAAGACATGTGGG - Intergenic
984539927 4:181024630-181024652 GAAGATGGGGGCAGAGATTGAGG - Intergenic
984561362 4:181274893-181274915 GAGAATGGTGGAATAGATTTTGG + Intergenic
984978307 4:185251395-185251417 GAGGCTGGAGGAAGAGAAAGGGG - Intronic
985003666 4:185511437-185511459 GAAGCTGGAGGCAGAGGTTGCGG - Intronic
985993545 5:3583606-3583628 GAAGCTGAAGGCAGAGATTGGGG + Intergenic
986215606 5:5716291-5716313 GAGGGTGGAGGGAGAGACTGAGG + Intergenic
986815735 5:11407990-11408012 GAGGCAGGAGAAGGAGATTGGGG + Intronic
987850493 5:23346798-23346820 GAGGCTGAAGAATGAGATTGTGG - Intergenic
990020205 5:51117211-51117233 GAGGCTGGAGGTAGAGACAGAGG - Intergenic
990212201 5:53492519-53492541 GAGGATGGTTGAGGTGATTGAGG - Intergenic
991064103 5:62407328-62407350 GAGGCAGGAGGCAGAGGTTGCGG + Intronic
991610244 5:68442354-68442376 GAGGGTGGAGGAGGAGAGTGGGG - Intergenic
992240098 5:74759680-74759702 GAAGTAGGTGGCAGAGATTGGGG - Intronic
992991306 5:82286431-82286453 TAGGCTGGGATAAGAGATTGGGG + Intronic
993313398 5:86367605-86367627 GAGGCTGCTGGAAGAAATGTGGG + Intergenic
993579089 5:89636849-89636871 GAGGCTGGGGTAAGAGATGGGGG + Intergenic
994413481 5:99439119-99439141 GAGACTGGTGGATGAGATACAGG + Intergenic
994587912 5:101734383-101734405 GAAGCTGGTGGAAGTGAATCTGG + Intergenic
994709471 5:103249035-103249057 GAGGCTGTTGGAAAGGATTTGGG - Intergenic
997206265 5:132051983-132052005 GAGGCGGGTGGATCAGGTTGAGG + Intergenic
997585345 5:135040135-135040157 GGGGCTGGTGGTCGAGTTTGGGG + Intronic
998038811 5:138937911-138937933 GAGGAGGGTGGAAGAGGTTGGGG - Intergenic
998040992 5:138951017-138951039 CAGACAGTTGGAAGAGATTGGGG - Intronic
998090421 5:139363617-139363639 GAGGCTGAGGCAAGAGATCGAGG + Intronic
999257486 5:150217692-150217714 GAGGAAGGTGGAGCAGATTGTGG + Intronic
999443544 5:151621023-151621045 GGGGGTGGTGGAGGAGGTTGGGG + Intergenic
999730906 5:154476272-154476294 GAGGCTGGCGGAAGTGTGTGGGG - Intronic
999877258 5:155821414-155821436 GAGGCTGAGGCAAGAGAATGGGG - Intergenic
1001054401 5:168437041-168437063 GAGGCTGGAGGAAGAGTTTTGGG - Intronic
1001111805 5:168902864-168902886 GAGGCTGTTGAATGAGAATGGGG + Intronic
1001214166 5:169839817-169839839 GAGGCTGGAGGGACAAATTGAGG - Intronic
1001369002 5:171177368-171177390 GAAGCAGGTGGAAGAGATTGTGG - Intronic
1001529783 5:172454048-172454070 GAGGCGGGAGGAAGGGATGGAGG + Intronic
1002025801 5:176395566-176395588 GAGGGTGGTGGTGGGGATTGTGG - Intronic
1002723536 5:181280632-181280654 GAGGGAGGGGGAAGAGAGTGTGG - Intergenic
1003269050 6:4591349-4591371 GGGGCTGGTGCAACAGATTCAGG - Intergenic
1003774027 6:9339533-9339555 GAGGCTGGGGCAGGAGAATGGGG - Intergenic
1003863931 6:10346641-10346663 GAGGCAGGAGGAAGAGAGAGAGG + Intergenic
1004320296 6:14626700-14626722 GAAGGTGGAGGCAGAGATTGGGG - Intergenic
1004611984 6:17250778-17250800 GAGGCGGGTGGGAAAGAGTGGGG - Intergenic
1004897401 6:20161930-20161952 GAGGCTGGTATCTGAGATTGAGG + Intronic
1004927162 6:20427021-20427043 GATGCTGGGGGAAGAAAATGGGG + Intronic
1006149429 6:31978698-31978720 AAGGCAGGTGGATGAGAATGTGG + Intronic
1006452981 6:34115734-34115756 GAGGCTGGAGGAGGAGTTCGAGG + Intronic
1006555968 6:34867233-34867255 GATCCTGGTGGAACAGATTCTGG - Exonic
1006698346 6:35951118-35951140 GAGGTTGGGGGAAGGGATTGAGG - Intronic
1006781952 6:36637891-36637913 GAGGCTGGTAGAAGAGATGGTGG - Intergenic
1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG + Intergenic
1006924614 6:37647648-37647670 GAAGATGGGGAAAGAGATTGGGG + Intronic
1006943014 6:37765479-37765501 GAGGGTGGAGGAAGGGAGTGGGG - Intergenic
1007316101 6:40990467-40990489 GAGGCAGTTGGAAGTGCTTGAGG - Intergenic
1007577915 6:42938095-42938117 TGTGCTGGTGGAAGAGTTTGAGG + Exonic
1008661015 6:53667987-53668009 GAGGTTGGTGGAAGAGAGACAGG - Intergenic
1008957876 6:57235582-57235604 TGGGGTGGTAGAAGAGATTGGGG - Intergenic
1009001654 6:57724176-57724198 GCGGCTGGTGCAACAGGTTGGGG + Intergenic
1009193266 6:60655117-60655139 GTGGCTGGGGAAAGTGATTGGGG - Intergenic
1009959804 6:70504874-70504896 GAGGCAGGTGGTAGAGGTGGAGG + Intronic
1010278363 6:73994857-73994879 GAGGTTGGGACAAGAGATTGAGG + Intergenic
1012020555 6:93913066-93913088 GAGGCTGGGTAAATAGATTGGGG - Intergenic
1012295718 6:97520115-97520137 GAGGCTGGTGAGAGTGGTTGGGG + Intergenic
1013130327 6:107226601-107226623 GAGGCTGGAGGGACAGACTGAGG + Intronic
1013493437 6:110673586-110673608 CAGGCTGGTGGAACAGCTGGTGG + Intronic
1015235625 6:130967627-130967649 GAAGCTGCTGAAAGAGATTGGGG - Intronic
1015344209 6:132136496-132136518 GAACCTGGGGGCAGAGATTGCGG - Intergenic
1015567302 6:134586845-134586867 GAGGCTGGGGCAGGAGAATGGGG - Intergenic
1017883597 6:158579908-158579930 GGGGCTGGGGGAAGGGAATGGGG + Intronic
1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG + Intergenic
1019353105 7:564344-564366 GAGGCTGGCGGCGGAGGTTGAGG - Intronic
1019355533 7:576894-576916 GAGGCTGGAGTAAGAGCCTGCGG - Intronic
1020030705 7:4930720-4930742 GACGGTGGAGGCAGAGATTGTGG + Intronic
1020430679 7:8113508-8113530 GAGGCTGGGGGCAGAGAAGGAGG + Exonic
1021041005 7:15862232-15862254 CTGGCTGGTGTAAGTGATTGAGG + Intergenic
1021822457 7:24511719-24511741 GGGGCTGGTCTGAGAGATTGAGG - Intergenic
1022414036 7:30162889-30162911 GAGGCTGGGGGAAGAGAGGGAGG + Intergenic
1022599300 7:31741869-31741891 GAGGCTGCAGGAAGAGAATTGGG - Intergenic
1023089372 7:36603342-36603364 GGAGCTGGAGGAAGAGCTTGTGG - Intronic
1023583115 7:41702459-41702481 GGGGATGGTGAAAGAGAATGGGG + Intronic
1024215291 7:47243374-47243396 GAGGGTGGTGGAAGGGAGGGAGG - Intergenic
1024324044 7:48094935-48094957 GATGCTTGTGAAAGAGACTGAGG + Intronic
1024702350 7:51918192-51918214 GAGAATGGTGGAAGGGGTTGTGG - Intergenic
1026056867 7:66992639-66992661 GAGGTTTGGGGAAGAGATGGAGG - Intronic
1026739909 7:72972702-72972724 GAGGCTGGAGGAGGAGGTTCAGG - Intergenic
1027103824 7:75392368-75392390 GAGGCTGGAGGAGGAGGTTCAGG + Intergenic
1027661594 7:80994487-80994509 GAGGCTGAGGCAAGAGAATGGGG - Intergenic
1029537194 7:101163694-101163716 GAGGGTGGGGGAAGAGGATGAGG - Exonic
1029652347 7:101902135-101902157 GAGGCATGGGGAAGAGATGGTGG + Intronic
1029792915 7:102864161-102864183 GAGGCTGGAGAAAGAGATGGAGG - Intronic
1030314404 7:108099231-108099253 GAGCTTGATGGAAGAGATTCTGG + Intronic
1030437700 7:109545772-109545794 AAAACTGGTGAAAGAGATTGTGG + Intergenic
1032836935 7:135683338-135683360 CAGGCTGGTGGCAGATATTCAGG - Intronic
1032898838 7:136283192-136283214 GAAGATGGTGGAAGACAGTGAGG - Intergenic
1033128837 7:138728298-138728320 CAGGGTGGTGGGGGAGATTGCGG - Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033354186 7:140586154-140586176 GAAGCTGGTGGCAGCCATTGTGG + Intronic
1033577687 7:142701837-142701859 GAGGCAGGTGGATCAGTTTGAGG + Intergenic
1034043937 7:147907857-147907879 GAGACTGGGGGCAGAGGTTGCGG - Intronic
1035106915 7:156448907-156448929 GATGCTGATGGAAGTGATGGTGG + Intergenic
1035650729 8:1261908-1261930 GAGGCTGGTGGCAGCGTGTGCGG + Intergenic
1035956734 8:4088749-4088771 GAGGCTGTTGGAATAAATGGTGG - Intronic
1036165186 8:6426085-6426107 GAGGCGGGTGGAAGAGAACGAGG - Intronic
1039159874 8:34605641-34605663 GAGGCTGGAGGTGGAGATTGGGG - Intergenic
1039469027 8:37802330-37802352 AAAGCTGGTGGAAGAGAAGGGGG - Intronic
1039472300 8:37821063-37821085 GAGGGTGGTGGGAGAGAGAGAGG - Intronic
1040857242 8:51960885-51960907 GAGGATGGTGGGAAAGATTGGGG + Intergenic
1040871146 8:52101066-52101088 GGGGCAGGTGGAAGAGGCTGGGG + Intergenic
1042522951 8:69733713-69733735 GTGGCAGGTGAAAGAGAGTGAGG - Intronic
1043070782 8:75633291-75633313 GAAGATGGAGGTAGAGATTGTGG - Intergenic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1043526064 8:81097541-81097563 GAGGCTGGAGGAGGAGGTGGGGG + Intronic
1044340975 8:91045773-91045795 GAGGATGGAGGAAGAGATCAAGG + Intergenic
1045011552 8:97963297-97963319 TAGGCTGGTGGAGGAGCTTCAGG + Intronic
1045119851 8:99024952-99024974 GACACTGGTGAAAGAAATTGAGG - Intronic
1045205828 8:100039453-100039475 GAGCCTGGAGGCAGAGGTTGCGG - Intronic
1045344579 8:101282721-101282743 GAGGCAGGTATAAGAGAGTGGGG + Intergenic
1045457433 8:102395098-102395120 GAGGCTGGTGGGAGAGCTGTAGG - Intronic
1047148883 8:122238265-122238287 GAGGATAGTGAAAGAGATTATGG + Intergenic
1047499111 8:125429169-125429191 TAGGCTGGTGGAAGTCATTCTGG - Intergenic
1047582979 8:126237107-126237129 GAGGCTGGAGGAAATGAGTGTGG + Intergenic
1047633061 8:126729215-126729237 GATGCTGGTGGAAGAGGTTAAGG + Intergenic
1047965681 8:130044924-130044946 GACGCTGGAGGAAGGGTTTGGGG - Intergenic
1048115216 8:131514120-131514142 GAGCCTGGTGGAGGTGTTTGGGG + Intergenic
1048497496 8:134947286-134947308 GTGGCTGGGGGAAGAGGTGGAGG - Intergenic
1048537973 8:135315445-135315467 GAGGCGGGTGCAAGAGAGAGGGG - Intergenic
1048547542 8:135401657-135401679 GAGGCTGGGGGTAGGGATGGGGG + Intergenic
1049326892 8:142026251-142026273 GAGGCTGGTGGGAAGGACTGGGG - Intergenic
1049328509 8:142037572-142037594 CAGGCTGGTGGGCCAGATTGGGG - Intergenic
1049824491 8:144659873-144659895 GAGACTGGGGGAACAGAATGAGG - Intergenic
1050031409 9:1390158-1390180 GAGGCTGGGGAATGGGATTGTGG - Intergenic
1050658657 9:7858323-7858345 GATGCTGGAGGATGGGATTGAGG + Intronic
1050731404 9:8713688-8713710 CATGATGGTGGAAGAGATCGCGG + Intronic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1055176498 9:73324011-73324033 GAGGCTGAGGCAAGAGAATGGGG + Intergenic
1055555000 9:77464940-77464962 GAAGATGGAGGCAGAGATTGGGG + Intronic
1056409915 9:86314960-86314982 GAGGTTGATGGAAGAGATGGAGG - Intronic
1056672878 9:88646306-88646328 GAGGCTGGGGCAGGAGAATGGGG + Intergenic
1056703728 9:88933760-88933782 GAAGATGGAGGCAGAGATTGGGG + Intergenic
1057307430 9:93920440-93920462 GATGCTGGGGGAACAGATTCTGG + Intergenic
1057697060 9:97330701-97330723 GAAGCTGGAGGAAGAGAAGGAGG + Exonic
1057810548 9:98253833-98253855 AAGTCTGGTGGGAGAGACTGAGG - Intronic
1058160182 9:101561981-101562003 GATTCTGATGGAAGAGATTAAGG + Exonic
1058162819 9:101588109-101588131 GAGTCTGGTTGAAGAGAGTTAGG + Intronic
1058333244 9:103791388-103791410 GGAGCAGGAGGAAGAGATTGAGG - Intergenic
1058613788 9:106803959-106803981 GAGGCTGAGGCAAGAGAATGGGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1059851423 9:118345589-118345611 AAGGCTGGTAGAAAAGATTGTGG + Intergenic
1059967610 9:119631186-119631208 GAAGAGGGTGGAAGAGATTTTGG - Intergenic
1060033878 9:120238365-120238387 GAGGCTGGAGGAAGGAATTTTGG - Intergenic
1060734918 9:126060642-126060664 GAGGGTGGTGGAAGGGAGTGGGG + Intergenic
1060976132 9:127766288-127766310 AAGGCAGGTGGCAGAGGTTGGGG - Intronic
1061316068 9:129796509-129796531 GAGGCTGGTGGCAGGGAGGGAGG + Intergenic
1061478467 9:130884642-130884664 CAGGCTGGTGAAAAAGAATGAGG + Exonic
1061567153 9:131448650-131448672 GAGGAAGGAGGAAGAGTTTGAGG - Intronic
1061904494 9:133689740-133689762 GAGGCTGGGAGAAGGGACTGGGG - Intronic
1062291122 9:135794879-135794901 GAGGCTGGGAGAAGTGATGGTGG - Intergenic
1062315016 9:135962852-135962874 GAAGCTGGTGGAGGAGAAAGGGG + Intergenic
1062327469 9:136019122-136019144 GAGGCTGCGTGAAGACATTGAGG - Intronic
1062525349 9:136976030-136976052 GAGTCTGTTGGAACAGATAGGGG - Intergenic
1185499046 X:583946-583968 GAGGCTGGAGGAGGAGAAGGAGG + Intergenic
1185539864 X:894517-894539 GATGATGGAGGCAGAGATTGAGG + Intergenic
1185830105 X:3293308-3293330 GAGGCAGGAGGAGGAGAATGAGG + Intergenic
1185837170 X:3355851-3355873 GACTCTGGAAGAAGAGATTGGGG + Intergenic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1186487714 X:9946388-9946410 GAGGCAGGTGGGAGAGAGTCAGG + Intronic
1186529679 X:10282535-10282557 GGGCCTGGTGGAAGTTATTGGGG - Intergenic
1187288892 X:17932932-17932954 GATGATGGAGGCAGAGATTGGGG - Intergenic
1187322374 X:18251230-18251252 GAAACTGGTGGCAGAGGTTGCGG + Intronic
1187942771 X:24398102-24398124 GATCCTGGAGAAAGAGATTGGGG + Intergenic
1189600921 X:42624311-42624333 GAGACTGGAGGAAAAGAATGTGG + Intergenic
1190128382 X:47725113-47725135 GAGGGTGGAGGGAGAGAATGGGG - Intergenic
1191885217 X:65881206-65881228 GAGGATGGTGGAGAAGAATGAGG + Intergenic
1192566225 X:72165955-72165977 GGGGCTGGAGAAAGAGATTTGGG - Intergenic
1195301428 X:103533875-103533897 GAGGTGAGTGGAAGAGAATGGGG + Intergenic
1196061039 X:111408521-111408543 GAGGCAGGAGGCAGAGGTTGTGG + Intronic
1197045825 X:121997013-121997035 TAGACAGGTGGAATAGATTGGGG + Intergenic
1197457150 X:126691181-126691203 GAGGTTGGAGAAAGAGAATGAGG + Intergenic
1197700802 X:129598090-129598112 GAGGTGGGTGGAAGAGACTAAGG - Intergenic
1197765223 X:130055801-130055823 GAGGCTGGAGGAAGCGGTGGGGG - Intronic
1197902592 X:131390167-131390189 GAGGTAGGTGGAAGAGAAGGTGG + Intronic
1197905058 X:131415793-131415815 GAGGTTGGTGGACAAGGTTGGGG - Intergenic
1198563812 X:137882573-137882595 GAGGCTGATGAAAGATACTGAGG - Intergenic
1200086221 X:153607706-153607728 GGGGCTGGGGGATGAGAGTGTGG + Intergenic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic