ID: 940992724

View in Genome Browser
Species Human (GRCh38)
Location 2:160114477-160114499
Sequence CACCCTCCCTGGACCTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940992724_940992731 2 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992731 2:160114502-160114524 AAAAATACAAAGCAGGGGGGTGG No data
940992724_940992727 -4 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992727 2:160114496-160114518 GGTGTGAAAAATACAAAGCAGGG No data
940992724_940992732 13 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992732 2:160114513-160114535 GCAGGGGGGTGGAGCCAAGATGG No data
940992724_940992730 -1 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992730 2:160114499-160114521 GTGAAAAATACAAAGCAGGGGGG No data
940992724_940992733 22 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992733 2:160114522-160114544 TGGAGCCAAGATGGCCGAATAGG 0: 383
1: 2192
2: 1245
3: 872
4: 1209
940992724_940992726 -5 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992726 2:160114495-160114517 GGGTGTGAAAAATACAAAGCAGG No data
940992724_940992729 -2 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992729 2:160114498-160114520 TGTGAAAAATACAAAGCAGGGGG No data
940992724_940992728 -3 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992728 2:160114497-160114519 GTGTGAAAAATACAAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940992724 Original CRISPR CACCCTCCCTGGACCTTCCC AGG (reversed) Intronic
No off target data available for this crispr