ID: 940992730

View in Genome Browser
Species Human (GRCh38)
Location 2:160114499-160114521
Sequence GTGAAAAATACAAAGCAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940992724_940992730 -1 Left 940992724 2:160114477-160114499 CCTGGGAAGGTCCAGGGAGGGTG No data
Right 940992730 2:160114499-160114521 GTGAAAAATACAAAGCAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940992730 Original CRISPR GTGAAAAATACAAAGCAGGG GGG Intronic
No off target data available for this crispr