ID: 940995069

View in Genome Browser
Species Human (GRCh38)
Location 2:160140399-160140421
Sequence CAGAGCAAGCAGAGGCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940995065_940995069 -10 Left 940995065 2:160140386-160140408 CCATAACCTCTGGCAGAGCAAGC No data
Right 940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG No data
940995061_940995069 29 Left 940995061 2:160140347-160140369 CCTGTAAGTTGCGTGAAGTATTT No data
Right 940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG No data
940995060_940995069 30 Left 940995060 2:160140346-160140368 CCCTGTAAGTTGCGTGAAGTATT No data
Right 940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940995069 Original CRISPR CAGAGCAAGCAGAGGCATGG CGG Intronic
No off target data available for this crispr