ID: 941008245

View in Genome Browser
Species Human (GRCh38)
Location 2:160269645-160269667
Sequence CTTGAACACCTCCAGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941008245_941008252 -3 Left 941008245 2:160269645-160269667 CCTGGTCCCTGGAGGTGTTCAAG No data
Right 941008252 2:160269665-160269687 AAGTAGGGCAGGTGGCTTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 211
941008245_941008255 29 Left 941008245 2:160269645-160269667 CCTGGTCCCTGGAGGTGTTCAAG No data
Right 941008255 2:160269697-160269719 GATAGGAAATCCCTGCAGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
941008245_941008253 7 Left 941008245 2:160269645-160269667 CCTGGTCCCTGGAGGTGTTCAAG No data
Right 941008253 2:160269675-160269697 GGTGGCTTCAAGGATACTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 67
941008245_941008254 12 Left 941008245 2:160269645-160269667 CCTGGTCCCTGGAGGTGTTCAAG No data
Right 941008254 2:160269680-160269702 CTTCAAGGATACTAGAGGATAGG 0: 1
1: 0
2: 0
3: 6
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941008245 Original CRISPR CTTGAACACCTCCAGGGACC AGG (reversed) Intronic
No off target data available for this crispr