ID: 941008365

View in Genome Browser
Species Human (GRCh38)
Location 2:160270320-160270342
Sequence CCGCGGGGCCCCCCGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941008365_941008376 8 Left 941008365 2:160270320-160270342 CCTGCGCCCGGGGGGCCCCGCGG No data
Right 941008376 2:160270351-160270373 CCCCCATCTGGCTCTCGGCCTGG No data
941008365_941008383 18 Left 941008365 2:160270320-160270342 CCTGCGCCCGGGGGGCCCCGCGG No data
Right 941008383 2:160270361-160270383 GCTCTCGGCCTGGACTGAGGGGG No data
941008365_941008380 15 Left 941008365 2:160270320-160270342 CCTGCGCCCGGGGGGCCCCGCGG No data
Right 941008380 2:160270358-160270380 CTGGCTCTCGGCCTGGACTGAGG No data
941008365_941008381 16 Left 941008365 2:160270320-160270342 CCTGCGCCCGGGGGGCCCCGCGG No data
Right 941008381 2:160270359-160270381 TGGCTCTCGGCCTGGACTGAGGG No data
941008365_941008374 3 Left 941008365 2:160270320-160270342 CCTGCGCCCGGGGGGCCCCGCGG No data
Right 941008374 2:160270346-160270368 CGTGACCCCCATCTGGCTCTCGG No data
941008365_941008372 -4 Left 941008365 2:160270320-160270342 CCTGCGCCCGGGGGGCCCCGCGG No data
Right 941008372 2:160270339-160270361 GCGGCCACGTGACCCCCATCTGG No data
941008365_941008382 17 Left 941008365 2:160270320-160270342 CCTGCGCCCGGGGGGCCCCGCGG No data
Right 941008382 2:160270360-160270382 GGCTCTCGGCCTGGACTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941008365 Original CRISPR CCGCGGGGCCCCCCGGGCGC AGG (reversed) Intronic