ID: 941010769

View in Genome Browser
Species Human (GRCh38)
Location 2:160297197-160297219
Sequence CAGGGGAGAAAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941010762_941010769 5 Left 941010762 2:160297169-160297191 CCAGCTAAACATAAGATGACTAA No data
Right 941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941010769 Original CRISPR CAGGGGAGAAAGATGGAGGA GGG Intronic
No off target data available for this crispr