ID: 941011756

View in Genome Browser
Species Human (GRCh38)
Location 2:160308118-160308140
Sequence AATCATTTCCCCACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941011751_941011756 13 Left 941011751 2:160308082-160308104 CCCAAGCACAGGGGCTGGACTTA No data
Right 941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG No data
941011749_941011756 20 Left 941011749 2:160308075-160308097 CCTATCACCCAAGCACAGGGGCT No data
Right 941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG No data
941011744_941011756 24 Left 941011744 2:160308071-160308093 CCTCCCTATCACCCAAGCACAGG No data
Right 941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG No data
941011743_941011756 25 Left 941011743 2:160308070-160308092 CCCTCCCTATCACCCAAGCACAG No data
Right 941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG No data
941011752_941011756 12 Left 941011752 2:160308083-160308105 CCAAGCACAGGGGCTGGACTTAA No data
Right 941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG No data
941011748_941011756 21 Left 941011748 2:160308074-160308096 CCCTATCACCCAAGCACAGGGGC No data
Right 941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941011756 Original CRISPR AATCATTTCCCCACTGGGTG TGG Intronic
No off target data available for this crispr