ID: 941016582

View in Genome Browser
Species Human (GRCh38)
Location 2:160364322-160364344
Sequence GAAACACGTACGAGGAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941016582_941016584 3 Left 941016582 2:160364322-160364344 CCAAGATTCCTCGTACGTGTTTC No data
Right 941016584 2:160364348-160364370 ATTTAGAAGTTAACTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941016582 Original CRISPR GAAACACGTACGAGGAATCT TGG (reversed) Intronic