ID: 941016582 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:160364322-160364344 |
| Sequence | GAAACACGTACGAGGAATCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941016582_941016584 | 3 | Left | 941016582 | 2:160364322-160364344 | CCAAGATTCCTCGTACGTGTTTC | No data | ||
| Right | 941016584 | 2:160364348-160364370 | ATTTAGAAGTTAACTAGAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941016582 | Original CRISPR | GAAACACGTACGAGGAATCT TGG (reversed) | Intronic | ||