ID: 941016583

View in Genome Browser
Species Human (GRCh38)
Location 2:160364330-160364352
Sequence TAAATTGTGAAACACGTACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941016583_941016584 -5 Left 941016583 2:160364330-160364352 CCTCGTACGTGTTTCACAATTTA No data
Right 941016584 2:160364348-160364370 ATTTAGAAGTTAACTAGAGCTGG No data
941016583_941016585 23 Left 941016583 2:160364330-160364352 CCTCGTACGTGTTTCACAATTTA No data
Right 941016585 2:160364376-160364398 ATCTTTCATTAAATGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941016583 Original CRISPR TAAATTGTGAAACACGTACG AGG (reversed) Intronic