ID: 941016584

View in Genome Browser
Species Human (GRCh38)
Location 2:160364348-160364370
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941016582_941016584 3 Left 941016582 2:160364322-160364344 CCAAGATTCCTCGTACGTGTTTC No data
Right 941016584 2:160364348-160364370 ATTTAGAAGTTAACTAGAGCTGG No data
941016583_941016584 -5 Left 941016583 2:160364330-160364352 CCTCGTACGTGTTTCACAATTTA No data
Right 941016584 2:160364348-160364370 ATTTAGAAGTTAACTAGAGCTGG No data
941016581_941016584 21 Left 941016581 2:160364304-160364326 CCTACAGCAGTCAAGGTTCCAAG No data
Right 941016584 2:160364348-160364370 ATTTAGAAGTTAACTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr