ID: 941016585

View in Genome Browser
Species Human (GRCh38)
Location 2:160364376-160364398
Sequence ATCTTTCATTAAATGTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941016583_941016585 23 Left 941016583 2:160364330-160364352 CCTCGTACGTGTTTCACAATTTA No data
Right 941016585 2:160364376-160364398 ATCTTTCATTAAATGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941016585 Original CRISPR ATCTTTCATTAAATGTTTCT AGG Intronic
No off target data available for this crispr