ID: 941017700

View in Genome Browser
Species Human (GRCh38)
Location 2:160375336-160375358
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941017700 Original CRISPR GAATCACTTATGACTAAGTC GGG (reversed) Intronic
No off target data available for this crispr