ID: 941045593

View in Genome Browser
Species Human (GRCh38)
Location 2:160671759-160671781
Sequence GTGCAGTACTTGAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941045584_941045593 8 Left 941045584 2:160671728-160671750 CCAGAGCAGGGAGCCTCTTGCCC No data
Right 941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG No data
941045587_941045593 -5 Left 941045587 2:160671741-160671763 CCTCTTGCCCGGGTAAGAGTGCA No data
Right 941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941045593 Original CRISPR GTGCAGTACTTGAGGGAAGG TGG Intergenic
No off target data available for this crispr