ID: 941047338

View in Genome Browser
Species Human (GRCh38)
Location 2:160691268-160691290
Sequence GCAACGGTGTTAAATGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941047335_941047338 -4 Left 941047335 2:160691249-160691271 CCATCAAAGAAACAGAAAGGCAA No data
Right 941047338 2:160691268-160691290 GCAACGGTGTTAAATGCTGCGGG No data
941047333_941047338 21 Left 941047333 2:160691224-160691246 CCAGGAAAAGGTAGTGTTAGAGA No data
Right 941047338 2:160691268-160691290 GCAACGGTGTTAAATGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941047338 Original CRISPR GCAACGGTGTTAAATGCTGC GGG Intergenic
No off target data available for this crispr