ID: 941058410

View in Genome Browser
Species Human (GRCh38)
Location 2:160815328-160815350
Sequence TGGTGTAAAGATTCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941058407_941058410 18 Left 941058407 2:160815287-160815309 CCAAGAAGAAACCAGTAAGGTAC No data
Right 941058410 2:160815328-160815350 TGGTGTAAAGATTCTGTTGCTGG No data
941058408_941058410 7 Left 941058408 2:160815298-160815320 CCAGTAAGGTACTTTTAAAACTT No data
Right 941058410 2:160815328-160815350 TGGTGTAAAGATTCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941058410 Original CRISPR TGGTGTAAAGATTCTGTTGC TGG Intergenic
No off target data available for this crispr