ID: 941058669

View in Genome Browser
Species Human (GRCh38)
Location 2:160819159-160819181
Sequence GATTTATAATGACCAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941058669_941058670 4 Left 941058669 2:160819159-160819181 CCAGGTTTTGGTCATTATAAATC No data
Right 941058670 2:160819186-160819208 TTCTATAAACATTCATGTCCAGG No data
941058669_941058671 15 Left 941058669 2:160819159-160819181 CCAGGTTTTGGTCATTATAAATC No data
Right 941058671 2:160819197-160819219 TTCATGTCCAGGTTTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941058669 Original CRISPR GATTTATAATGACCAAAACC TGG (reversed) Intergenic
No off target data available for this crispr