ID: 941062032

View in Genome Browser
Species Human (GRCh38)
Location 2:160857642-160857664
Sequence ACTCCTGGGGGCTCCGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941062032_941062037 -6 Left 941062032 2:160857642-160857664 CCAAAGGCGGAGCCCCCAGGAGT No data
Right 941062037 2:160857659-160857681 AGGAGTTTCTAAGTCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941062032 Original CRISPR ACTCCTGGGGGCTCCGCCTT TGG (reversed) Intergenic