ID: 941062037

View in Genome Browser
Species Human (GRCh38)
Location 2:160857659-160857681
Sequence AGGAGTTTCTAAGTCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941062030_941062037 -4 Left 941062030 2:160857640-160857662 CCCCAAAGGCGGAGCCCCCAGGA No data
Right 941062037 2:160857659-160857681 AGGAGTTTCTAAGTCTTTGCTGG No data
941062025_941062037 12 Left 941062025 2:160857624-160857646 CCACAAATTCATAGGCCCCCAAA No data
Right 941062037 2:160857659-160857681 AGGAGTTTCTAAGTCTTTGCTGG No data
941062031_941062037 -5 Left 941062031 2:160857641-160857663 CCCAAAGGCGGAGCCCCCAGGAG No data
Right 941062037 2:160857659-160857681 AGGAGTTTCTAAGTCTTTGCTGG No data
941062032_941062037 -6 Left 941062032 2:160857642-160857664 CCAAAGGCGGAGCCCCCAGGAGT No data
Right 941062037 2:160857659-160857681 AGGAGTTTCTAAGTCTTTGCTGG No data
941062028_941062037 -3 Left 941062028 2:160857639-160857661 CCCCCAAAGGCGGAGCCCCCAGG No data
Right 941062037 2:160857659-160857681 AGGAGTTTCTAAGTCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941062037 Original CRISPR AGGAGTTTCTAAGTCTTTGC TGG Intergenic