ID: 941064972

View in Genome Browser
Species Human (GRCh38)
Location 2:160891740-160891762
Sequence GTGGTGCTGTTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941064972_941064982 13 Left 941064972 2:160891740-160891762 CCCTCCTCCCTGAACAGCACCAC No data
Right 941064982 2:160891776-160891798 TATTAAAGGGCTTGTATTGATGG No data
941064972_941064981 0 Left 941064972 2:160891740-160891762 CCCTCCTCCCTGAACAGCACCAC No data
Right 941064981 2:160891763-160891785 CAAAGGCTGTCTTTATTAAAGGG No data
941064972_941064980 -1 Left 941064972 2:160891740-160891762 CCCTCCTCCCTGAACAGCACCAC No data
Right 941064980 2:160891762-160891784 CCAAAGGCTGTCTTTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941064972 Original CRISPR GTGGTGCTGTTCAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr