ID: 941066400

View in Genome Browser
Species Human (GRCh38)
Location 2:160907648-160907670
Sequence GGGACTTGAACGAGATGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941066389_941066400 30 Left 941066389 2:160907595-160907617 CCGTGTGTATTTTTTAAAGTTTG No data
Right 941066400 2:160907648-160907670 GGGACTTGAACGAGATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941066400 Original CRISPR GGGACTTGAACGAGATGTCA GGG Intergenic
No off target data available for this crispr