ID: 941066763

View in Genome Browser
Species Human (GRCh38)
Location 2:160911969-160911991
Sequence AGCAGATCGCTTCACTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941066760_941066763 13 Left 941066760 2:160911933-160911955 CCTGTTTATTGTTTGGTCTTTCA No data
Right 941066763 2:160911969-160911991 AGCAGATCGCTTCACTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941066763 Original CRISPR AGCAGATCGCTTCACTAAAC AGG Intergenic