ID: 941068180

View in Genome Browser
Species Human (GRCh38)
Location 2:160926862-160926884
Sequence AGAGCAACTATTCTGATTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941068180_941068184 18 Left 941068180 2:160926862-160926884 CCGATAATCAGAATAGTTGCTCT No data
Right 941068184 2:160926903-160926925 CTTTAAGAGACTAATGTTCTTGG No data
941068180_941068185 28 Left 941068180 2:160926862-160926884 CCGATAATCAGAATAGTTGCTCT No data
Right 941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941068180 Original CRISPR AGAGCAACTATTCTGATTAT CGG (reversed) Intergenic
No off target data available for this crispr