ID: 941068181

View in Genome Browser
Species Human (GRCh38)
Location 2:160926886-160926908
Sequence TTAAAGGACAGGTAAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941068181_941068184 -6 Left 941068181 2:160926886-160926908 CCTTTTCTTTACCTGTCCTTTAA No data
Right 941068184 2:160926903-160926925 CTTTAAGAGACTAATGTTCTTGG No data
941068181_941068185 4 Left 941068181 2:160926886-160926908 CCTTTTCTTTACCTGTCCTTTAA No data
Right 941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941068181 Original CRISPR TTAAAGGACAGGTAAAGAAA AGG (reversed) Intergenic
No off target data available for this crispr