ID: 941068182

View in Genome Browser
Species Human (GRCh38)
Location 2:160926897-160926919
Sequence ACATTAGTCTCTTAAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941068182_941068188 25 Left 941068182 2:160926897-160926919 CCTGTCCTTTAAGAGACTAATGT No data
Right 941068188 2:160926945-160926967 TAATAAAATATCACACAACCTGG No data
941068182_941068185 -7 Left 941068182 2:160926897-160926919 CCTGTCCTTTAAGAGACTAATGT No data
Right 941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941068182 Original CRISPR ACATTAGTCTCTTAAAGGAC AGG (reversed) Intergenic
No off target data available for this crispr