ID: 941068185

View in Genome Browser
Species Human (GRCh38)
Location 2:160926913-160926935
Sequence CTAATGTTCTTGGAGAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941068181_941068185 4 Left 941068181 2:160926886-160926908 CCTTTTCTTTACCTGTCCTTTAA No data
Right 941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG No data
941068182_941068185 -7 Left 941068182 2:160926897-160926919 CCTGTCCTTTAAGAGACTAATGT No data
Right 941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG No data
941068180_941068185 28 Left 941068180 2:160926862-160926884 CCGATAATCAGAATAGTTGCTCT No data
Right 941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941068185 Original CRISPR CTAATGTTCTTGGAGAGTCC AGG Intergenic
No off target data available for this crispr