ID: 941075732

View in Genome Browser
Species Human (GRCh38)
Location 2:161004390-161004412
Sequence TGCCAGTCCTCACTGACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941075732_941075735 6 Left 941075732 2:161004390-161004412 CCCTGAGTCAGTGAGGACTGGCA No data
Right 941075735 2:161004419-161004441 CTCTTCAGTGATTCTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941075732 Original CRISPR TGCCAGTCCTCACTGACTCA GGG (reversed) Intergenic
No off target data available for this crispr