ID: 941075774

View in Genome Browser
Species Human (GRCh38)
Location 2:161004994-161005016
Sequence GTTAAACTCAACAACGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941075774_941075782 5 Left 941075774 2:161004994-161005016 CCTTCCCCGTTGTTGAGTTTAAC No data
Right 941075782 2:161005022-161005044 GGTTTGCTATGGCCGGTGTAAGG No data
941075774_941075784 9 Left 941075774 2:161004994-161005016 CCTTCCCCGTTGTTGAGTTTAAC No data
Right 941075784 2:161005026-161005048 TGCTATGGCCGGTGTAAGGTGGG No data
941075774_941075783 8 Left 941075774 2:161004994-161005016 CCTTCCCCGTTGTTGAGTTTAAC No data
Right 941075783 2:161005025-161005047 TTGCTATGGCCGGTGTAAGGTGG No data
941075774_941075780 -2 Left 941075774 2:161004994-161005016 CCTTCCCCGTTGTTGAGTTTAAC No data
Right 941075780 2:161005015-161005037 ACCATGTGGTTTGCTATGGCCGG No data
941075774_941075779 -6 Left 941075774 2:161004994-161005016 CCTTCCCCGTTGTTGAGTTTAAC No data
Right 941075779 2:161005011-161005033 TTTAACCATGTGGTTTGCTATGG No data
941075774_941075785 12 Left 941075774 2:161004994-161005016 CCTTCCCCGTTGTTGAGTTTAAC No data
Right 941075785 2:161005029-161005051 TATGGCCGGTGTAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941075774 Original CRISPR GTTAAACTCAACAACGGGGA AGG (reversed) Intergenic
No off target data available for this crispr