ID: 941078567

View in Genome Browser
Species Human (GRCh38)
Location 2:161033984-161034006
Sequence TTCATCAGTTTCCAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941078565_941078567 14 Left 941078565 2:161033947-161033969 CCTAAGATAAAAATTCAAGTGTT No data
Right 941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG No data
941078564_941078567 15 Left 941078564 2:161033946-161033968 CCCTAAGATAAAAATTCAAGTGT No data
Right 941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG No data
941078563_941078567 18 Left 941078563 2:161033943-161033965 CCTCCCTAAGATAAAAATTCAAG No data
Right 941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG No data
941078562_941078567 25 Left 941078562 2:161033936-161033958 CCATCAACCTCCCTAAGATAAAA No data
Right 941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941078567 Original CRISPR TTCATCAGTTTCCAAAAAAC AGG Intergenic
No off target data available for this crispr