ID: 941086507

View in Genome Browser
Species Human (GRCh38)
Location 2:161124335-161124357
Sequence CAGACTGGTGTGCTTATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941086505_941086507 2 Left 941086505 2:161124310-161124332 CCACTAGGATAGGCTATAATCTA No data
Right 941086507 2:161124335-161124357 CAGACTGGTGTGCTTATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941086507 Original CRISPR CAGACTGGTGTGCTTATAAG AGG Intergenic
No off target data available for this crispr