ID: 941089602

View in Genome Browser
Species Human (GRCh38)
Location 2:161159869-161159891
Sequence GTGAAAAATACTACCAGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941089598_941089602 3 Left 941089598 2:161159843-161159865 CCATTCCTCTTTAACAAATACAT No data
Right 941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG No data
941089596_941089602 13 Left 941089596 2:161159833-161159855 CCATTTCCAGCCATTCCTCTTTA No data
Right 941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG No data
941089594_941089602 19 Left 941089594 2:161159827-161159849 CCACCTCCATTTCCAGCCATTCC No data
Right 941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG No data
941089597_941089602 7 Left 941089597 2:161159839-161159861 CCAGCCATTCCTCTTTAACAAAT No data
Right 941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG No data
941089599_941089602 -2 Left 941089599 2:161159848-161159870 CCTCTTTAACAAATACATTTAGT No data
Right 941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG No data
941089595_941089602 16 Left 941089595 2:161159830-161159852 CCTCCATTTCCAGCCATTCCTCT No data
Right 941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941089602 Original CRISPR GTGAAAAATACTACCAGTTG GGG Intronic
No off target data available for this crispr