ID: 941094023 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:161214916-161214938 |
Sequence | AAGGAGAGGCATATTGAGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
941094019_941094023 | 30 | Left | 941094019 | 2:161214863-161214885 | CCTAGGAGGTAACACAGACACAG | No data | ||
Right | 941094023 | 2:161214916-161214938 | AAGGAGAGGCATATTGAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
941094023 | Original CRISPR | AAGGAGAGGCATATTGAGCT TGG | Intronic | ||
No off target data available for this crispr |