ID: 941094023

View in Genome Browser
Species Human (GRCh38)
Location 2:161214916-161214938
Sequence AAGGAGAGGCATATTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941094019_941094023 30 Left 941094019 2:161214863-161214885 CCTAGGAGGTAACACAGACACAG No data
Right 941094023 2:161214916-161214938 AAGGAGAGGCATATTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941094023 Original CRISPR AAGGAGAGGCATATTGAGCT TGG Intronic
No off target data available for this crispr