ID: 941095940

View in Genome Browser
Species Human (GRCh38)
Location 2:161239176-161239198
Sequence CGATTCACCAGACAGCGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941095940_941095949 28 Left 941095940 2:161239176-161239198 CCCACTCGCTGTCTGGTGAATCG No data
Right 941095949 2:161239227-161239249 AGTCCAGGCGAATTCAGAAAGGG No data
941095940_941095947 13 Left 941095940 2:161239176-161239198 CCCACTCGCTGTCTGGTGAATCG No data
Right 941095947 2:161239212-161239234 GCGAGCGCGACTGGGAGTCCAGG No data
941095940_941095945 5 Left 941095940 2:161239176-161239198 CCCACTCGCTGTCTGGTGAATCG No data
Right 941095945 2:161239204-161239226 GTCGGCCAGCGAGCGCGACTGGG No data
941095940_941095944 4 Left 941095940 2:161239176-161239198 CCCACTCGCTGTCTGGTGAATCG No data
Right 941095944 2:161239203-161239225 CGTCGGCCAGCGAGCGCGACTGG No data
941095940_941095948 27 Left 941095940 2:161239176-161239198 CCCACTCGCTGTCTGGTGAATCG No data
Right 941095948 2:161239226-161239248 GAGTCCAGGCGAATTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941095940 Original CRISPR CGATTCACCAGACAGCGAGT GGG (reversed) Intergenic
No off target data available for this crispr