ID: 941099731

View in Genome Browser
Species Human (GRCh38)
Location 2:161282430-161282452
Sequence GTGTGACAGTAGCAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 28, 2: 7, 3: 31, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941099731_941099735 7 Left 941099731 2:161282430-161282452 CCATCCACTTGCTACTGTCACAC 0: 2
1: 28
2: 7
3: 31
4: 199
Right 941099735 2:161282460-161282482 AGCAGAAGAGGCCCCTGTAATGG No data
941099731_941099733 -5 Left 941099731 2:161282430-161282452 CCATCCACTTGCTACTGTCACAC 0: 2
1: 28
2: 7
3: 31
4: 199
Right 941099733 2:161282448-161282470 CACACTCTTGCCAGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941099731 Original CRISPR GTGTGACAGTAGCAAGTGGA TGG (reversed) Intergenic
900034254 1:393745-393767 GTGGGACAGTAGCAATTTGAAGG - Intergenic
900055089 1:623635-623657 GTGGGACAGTAGCAATTTGAAGG - Intergenic
900630946 1:3634858-3634880 ATGTCACAGTAGCAAGTTTACGG + Intronic
901254103 1:7806157-7806179 GTGTGACAGTTGAAATGGGAAGG + Intronic
902212223 1:14912392-14912414 GTAAGACAGTAGGGAGTGGAGGG + Intronic
903360667 1:22775051-22775073 GTGTGAGAATAGCAAGGGGCAGG - Intronic
908398973 1:63752439-63752461 GTGTGAGACAAGCATGTGGAGGG + Intergenic
912935892 1:114003412-114003434 GTGGGACTGTAGCAAGAAGAGGG - Intergenic
913013657 1:114710938-114710960 GTGTGACAGTATTTAATGGAAGG + Intronic
915840956 1:159212506-159212528 ATGTGACAAGAGCAAGTGAAGGG + Intergenic
916583307 1:166127740-166127762 GTGTGTCTGTAGCAGGCGGAGGG + Intronic
917208158 1:172600083-172600105 CTGTGCCTGTAGCAACTGGATGG - Exonic
917685117 1:177407956-177407978 CTGAGACAGTGGCAAGTGAAAGG - Intergenic
919502160 1:198350592-198350614 GTGTGCCAGTAGACAGGGGAGGG - Intergenic
919609598 1:199728426-199728448 GTGTGATAGTAGTAAGAGGTAGG - Intergenic
919893604 1:201994076-201994098 GTGTCACAGAAGCCAGAGGAGGG - Intronic
922205018 1:223438577-223438599 GTGTGACAGTATGAAGAGGTGGG + Intergenic
922256610 1:223897914-223897936 GTGGGACAGTAGCAATTTGAAGG - Intergenic
922333697 1:224600925-224600947 CTGTAACACTAGCAGGTGGACGG - Intronic
923540308 1:234884096-234884118 ATGTGACAGTGGCAGGTGAAGGG + Intergenic
924012235 1:239677707-239677729 GTGTCACAGTAGTAAGAGGTGGG - Intronic
924337816 1:243000773-243000795 GTAGGACAGTAGCAATTTGAAGG - Intergenic
1065339745 10:24693711-24693733 GTGTGGCAGGAGCCAGTGAATGG - Intronic
1065395259 10:25229333-25229355 AGGTTACAGTAGGAAGTGGATGG + Intronic
1070688828 10:78509795-78509817 GTGTCCCAGGAGCAAGTGCAGGG + Intergenic
1071233236 10:83613717-83613739 GTGTGATAGTATTAAGAGGAGGG + Intergenic
1071979344 10:90987930-90987952 CTGGGACAATAGCAAATGGATGG - Intergenic
1072442805 10:95471764-95471786 CAGTGACAGGAGGAAGTGGAAGG + Intronic
1073980317 10:109146627-109146649 GTGAGACAATAGGAAGGGGAGGG + Intergenic
1074444057 10:113503969-113503991 TTCTGCTAGTAGCAAGTGGATGG - Intergenic
1080141303 11:28923735-28923757 TTGCTACAGTAACAAGTGGATGG + Intergenic
1081053670 11:38380538-38380560 GTATGACAATAGCAAGTGTTTGG + Intergenic
1084565997 11:69929407-69929429 GTGTGGCTGTAGCATGTGGGTGG + Intergenic
1089143807 11:116309725-116309747 ATGTGACAGTATCAAGAGGTGGG + Intergenic
1090260624 11:125316172-125316194 GTGAGTCAGTAGCAACTGGCTGG - Intronic
1091607025 12:1962044-1962066 GGGTGTCAGCAGCAAGGGGAAGG + Intronic
1092024159 12:5226892-5226914 GTGTTACACAAGCAAGTGGCAGG - Intergenic
1094767352 12:33612308-33612330 GGGTGGCAGTAGCAGGTGGCAGG + Intergenic
1098293230 12:68978934-68978956 GTGTGACGATAGCAGGTGGTCGG - Intergenic
1099588697 12:84556240-84556262 GTTGGACAGCATCAAGTGGATGG + Intergenic
1102077163 12:110068780-110068802 AGGTTACAGTAGCAAGTGGCAGG - Intronic
1102401476 12:112633357-112633379 GTGTGGCAGTATCAAGAGGTGGG + Intronic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1106289606 13:28348399-28348421 GCGTGACTGAAGCAAGTGGGAGG - Intronic
1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG + Intronic
1114553539 14:23548253-23548275 GCCTGACAGTAGCAAGAGGAAGG - Intronic
1116814978 14:49575389-49575411 GAGTGACAGAAGGAAGGGGAAGG + Exonic
1118095541 14:62533139-62533161 CAGTGACAGTAACAAGTAGAAGG + Intergenic
1118638904 14:67773997-67774019 GTGTGACAGTATGAACTTGAGGG + Intronic
1118743669 14:68758905-68758927 GGGTGATAGAAGCCAGTGGAGGG - Intergenic
1122983038 14:105200129-105200151 GTGTGACAGTGTCATGAGGAGGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123876735 15:24630903-24630925 GTGTGGCAGTATCAAGTGGTGGG - Intergenic
1124493724 15:30173827-30173849 GGGTGACAGCAGCCAGTGCAGGG + Intergenic
1124749843 15:32364822-32364844 GGGTGACAGCAGCCAGTGCAGGG - Intergenic
1125755990 15:42065341-42065363 GGGTGACAGCAGCTAGTGGGGGG + Intergenic
1126461798 15:48922616-48922638 GTGTGAAAGTATCAAGAGGCAGG - Intronic
1127347447 15:58114667-58114689 AGGTGACAGTAGCAAGGAGAGGG - Intronic
1128108770 15:65063117-65063139 CTGTGACAGTATCGATTGGAAGG + Intronic
1129124870 15:73430942-73430964 GTGAGACAGTTGCAGGTGAAAGG - Intergenic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1131372551 15:91894804-91894826 GTGTGGCAGAAGCATGTGCAGGG - Intronic
1131506098 15:93020718-93020740 TTGTGAGAGTAGCAAGTCCAGGG + Intronic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1134762824 16:16729150-16729172 GTGAGCCAGGAGCAAGTGGCAGG - Intergenic
1134979447 16:18595224-18595246 GTGTCACAGAAGCACGTGAAAGG + Intergenic
1134983228 16:18629998-18630020 GTGAGCCAGGAGCAAGTGGCAGG + Intergenic
1135204780 16:20474265-20474287 GTGTAACAGTAGTAAGCGGTGGG + Intronic
1137963842 16:52911724-52911746 GTGAGACAGAAGCAACAGGAAGG + Intergenic
1138214674 16:55192924-55192946 ATGTGACAGTAGTAAGAGGTGGG + Intergenic
1143274985 17:5703754-5703776 GTGAGACAGTAGGAAGGGGTGGG - Intergenic
1143278172 17:5730255-5730277 GTGTCACAGTGGCTACTGGAAGG + Intergenic
1147963027 17:44179185-44179207 GTGTGAGAGGAGCCACTGGAGGG - Intergenic
1150335682 17:64329011-64329033 GTGTGACAGTGACAAGTGACGGG - Intronic
1153817090 18:8799969-8799991 GTGTGATAGAAGCACGTGGCGGG + Intronic
1155729253 18:29131821-29131843 GTTTGATTTTAGCAAGTGGATGG + Intergenic
1156488632 18:37483146-37483168 GTGTGCCACTAGCAAATGCAGGG - Intronic
1157413899 18:47486155-47486177 GTGTCACAGGAGGGAGTGGAGGG + Intergenic
1157464062 18:47930102-47930124 GTGTGAGAGCAGCGAGGGGAAGG + Intronic
1159324238 18:66894126-66894148 GTGGGACAATTGGAAGTGGAGGG + Intergenic
1159677644 18:71305691-71305713 GTGTGACAGTGCGAAGTGGGGGG + Intergenic
1160586083 18:79914458-79914480 GTCTGACAGCAGGAAGTGGGGGG + Intronic
1162571682 19:11478125-11478147 GGGTGACAGGAGGAGGTGGAGGG + Intronic
1163777972 19:19228909-19228931 GTGTGAGAGTAGTGAGTGGCCGG + Intronic
1164958607 19:32407230-32407252 GTTTGGCAGCAGCAAGTGGGAGG - Intronic
1166631704 19:44412464-44412486 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1166635921 19:44451991-44452013 GTGTGACAGTAGCAAGTAAAAGG + Intergenic
1166636473 19:44456157-44456179 GTGTGACAGTAGCAAGCAGATGG + Intergenic
1166638530 19:44473495-44473517 GTGTGGCAGTATGAAGTAGAAGG + Intergenic
1202648540 1_KI270706v1_random:161179-161201 GTGTGACAGTAGCAAGTAGATGG + Intergenic
925119528 2:1406760-1406782 TTCTGCCATTAGCAAGTGGAAGG + Intronic
925321620 2:2974462-2974484 GTGAGACATCAGCCAGTGGAGGG - Intergenic
925587031 2:5474807-5474829 GTGTGAACGTGGCAAGTGGGTGG - Intergenic
926548701 2:14274128-14274150 TTTTGACAGTAGCAAGTTGAGGG - Intergenic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
928742918 2:34376823-34376845 GTGTGACAGTATTAAGAGGTGGG + Intergenic
929018805 2:37529581-37529603 GTGTCACTGTAGCATGTGAAAGG + Intergenic
930202603 2:48559511-48559533 ATGTGACAGTAACAAGAGGTGGG - Intronic
931626658 2:64262390-64262412 GTGTGACAGAAACATGCGGAAGG + Intergenic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937264298 2:120606429-120606451 GTGTGCCAGAAGCAAGTGACAGG - Intergenic
938541305 2:132286211-132286233 GTGTGACAGTAGCAAGTAGATGG + Intergenic
939985211 2:148823496-148823518 GTGTGGGAGGAGCAAATGGATGG + Intergenic
940207079 2:151214798-151214820 ATGTTACAGTTGCTAGTGGAAGG - Intergenic
940325935 2:152424724-152424746 GTCTGCCAGAAGCAAATGGAGGG - Intronic
941099731 2:161282430-161282452 GTGTGACAGTAGCAAGTGGATGG - Intergenic
942770075 2:179506314-179506336 GTGAGACAGTGGCAACTGTAAGG + Intronic
943616360 2:190096955-190096977 GTGTAACAGTATCAAGAGGTGGG - Intronic
944672303 2:202005059-202005081 GTGCAACATTAGCCAGTGGAAGG + Intergenic
946128659 2:217586893-217586915 GAGTGACAGGAGCAAGAGGATGG - Intronic
946195864 2:218032888-218032910 GTGTGACAGTGGCAGGGAGAGGG - Intergenic
948148135 2:235723927-235723949 GTGTGAAAGTGGCAAAAGGAGGG + Intronic
948234658 2:236379272-236379294 GAGTGACAGGACCAAGGGGAGGG + Intronic
948910978 2:241002519-241002541 GTGTGACGGAAGCAGATGGAAGG + Intronic
948926075 2:241099048-241099070 GTGTGACAGGAGCCAGAGGTGGG - Intronic
1170527025 20:17249071-17249093 GTGTGACCATAGGAAGTGCAGGG + Intronic
1170545165 20:17429826-17429848 GTGTCAGAGTAGTAACTGGAAGG - Intronic
1171870212 20:30519233-30519255 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1172779300 20:37426276-37426298 GTGTTTCAGTAAGAAGTGGAGGG - Intergenic
1175167247 20:57053625-57053647 GTGTGACAGCAGGGAGTGGTGGG + Intergenic
1176553532 21:8242288-8242310 GTGGGACAGTATCAGGTGAAAGG + Intergenic
1176572454 21:8425312-8425334 GTGGGACAGTATCAGGTGAAAGG + Intergenic
1176580363 21:8469872-8469894 GTGGGACAGTATCAGGTGAAAGG + Intergenic
1176603313 21:8811508-8811530 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1176612161 21:8992875-8992897 GTGTGAGAGTAGCAAGTAGATGG - Intergenic
1179550265 21:42139408-42139430 GTGAGACAGCACCAAGAGGATGG + Intronic
1180345598 22:11703065-11703087 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1180352117 22:11814247-11814269 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1180353365 22:11821306-11821328 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1180384874 22:12171051-12171073 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1180386091 22:12177819-12177841 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1183959714 22:41404111-41404133 GTATGCCAGTAGCCATTGGAGGG - Intergenic
1184256387 22:43289406-43289428 ATGTGACAGCAGCAAGTGCCAGG + Intronic
1203258530 22_KI270733v1_random:159316-159338 GTGGGACAGTATCAGGTGAAAGG + Intergenic
951500145 3:23376879-23376901 ATGTGACATTCGCAAGGGGAGGG + Intronic
953038403 3:39233502-39233524 GGGTGACATTACCATGTGGATGG + Intergenic
957231222 3:77518196-77518218 TTGTCACAGGAGCAAGTGGGAGG + Intronic
958745466 3:98128645-98128667 GTGTGACAGTATTAAGAGGTGGG - Intergenic
958752062 3:98203326-98203348 GTGTGATAGTAGTAAGAGGTGGG - Intergenic
960997310 3:123348654-123348676 GTGGGAGAGAAGCAAGTGGAGGG + Intronic
964843868 3:161025184-161025206 GTGTGACAGTATCAAGAGGTGGG + Intronic
965688904 3:171334310-171334332 CTGTGACCGTAGAAACTGGAAGG + Intronic
966371188 3:179252207-179252229 GTGACACTGTAGGAAGTGGAGGG - Intronic
970401570 4:15722239-15722261 TTCTCACAGTAGCAAGTTGAAGG - Intronic
972701141 4:41494775-41494797 GTGTGCCAGTAGGGAGTGGTGGG + Intronic
973374766 4:49279143-49279165 GTGTGCCAGTAGCAAGTAGATGG + Intergenic
973375669 4:49285165-49285187 GTGTGACAGTAGCAAGTAGGTGG + Intergenic
973376567 4:49291184-49291206 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973377487 4:49297336-49297358 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973378405 4:49303472-49303494 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973379752 4:49311891-49311913 GTGTGACAGTAGCAAGTAGATGG - Intergenic
973380655 4:49318031-49318053 GTGTGACAGTAGCAAGTAGATGG - Intergenic
973381742 4:49325076-49325098 GTGTGACAGTAGCAAGTAGGTGG - Intergenic
973382645 4:49331098-49331120 GTGTGCCAGTAGCAAGTAGATGG - Intergenic
973386255 4:49516147-49516169 GTGTGACAGTAGCAAGTAGATGG - Intergenic
973597454 4:52507136-52507158 GTGAGACAGTAGGCAGTGGTGGG - Intergenic
973604489 4:52572932-52572954 ATGTGACAGTATTAAGAGGAGGG + Intergenic
974734636 4:65913420-65913442 ATGTAACAGTATCAAGTGGTGGG - Intergenic
975687923 4:76936160-76936182 GGATGACAGTAGCAAGTGTATGG + Intergenic
979239324 4:118434543-118434565 GTGGGACAGTAGCAATTTGAAGG + Intergenic
979282638 4:118884926-118884948 GAGTGATAGTAGCACGTGGAAGG + Intronic
980983306 4:139672121-139672143 TTGTGACACTAGCAAGTGTGAGG - Intronic
981166211 4:141560840-141560862 GTATGACAGTAGCAAGAACATGG - Intergenic
982104500 4:151999810-151999832 GTGAGAGGGCAGCAAGTGGAAGG - Intergenic
982739668 4:159044451-159044473 GTGTGATAGTAGGGAGGGGAGGG - Intergenic
983318643 4:166166690-166166712 TTCTGAAAGAAGCAAGTGGACGG - Intergenic
984171669 4:176367701-176367723 GTGTGACTGTAGCAAATGTTTGG + Intergenic
985397801 4:189563307-189563329 CTGTGTCCGTATCAAGTGGAGGG - Intergenic
986482646 5:8204309-8204331 GAGTGACAAGAGCAAGAGGAGGG - Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
988858150 5:35249170-35249192 ATGTGACAATATCAAGTGGTGGG - Intergenic
988966275 5:36421320-36421342 GTAAGACAGTTGAAAGTGGAAGG - Intergenic
989164996 5:38425093-38425115 GTGAGAAAGAAGCAAGTTGAAGG + Intronic
990100463 5:52178701-52178723 GTGTGACAGTACTAAGAGGTGGG - Intergenic
990827226 5:59914481-59914503 GTGTGGCTGGAGCAAGTTGAGGG + Intronic
993125201 5:83825929-83825951 GTGTGACTATAGCAAGTGTGAGG - Intergenic
996594806 5:125188130-125188152 GTGTGAGAGAAGAAAGTAGAGGG + Intergenic
996602192 5:125277330-125277352 GGATGACAGTACCAAGAGGATGG - Intergenic
997898895 5:137745381-137745403 GTGTGACAAAACCAAATGGAGGG + Intergenic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1001207197 5:169775220-169775242 GTGTGACAGAGACAAGTGTATGG + Intronic
1001400856 5:171445720-171445742 GGGTGAGAGTGGCAAGGGGAAGG + Intronic
1002739566 5:181425123-181425145 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1003444893 6:6175350-6175372 GTGGGACAGGCCCAAGTGGAAGG - Intronic
1003933231 6:10948708-10948730 GTGTCACACTAGCCTGTGGATGG + Intronic
1004327530 6:14689204-14689226 GTGTCACAGGAGGAAGAGGAAGG + Intergenic
1007316026 6:40989896-40989918 GTTTGACATAAGAAAGTGGAGGG + Intergenic
1008814263 6:55544542-55544564 GTGTGACAGTATAAACTGGTTGG - Intronic
1009958078 6:70481260-70481282 GGGTGACAGTAACAAGTTAAAGG - Intronic
1010660439 6:78564384-78564406 GTGTGACATCAGCAGGTTGAAGG + Intergenic
1013585337 6:111573449-111573471 TTCTGACAATAGCAAGTGGGAGG + Intronic
1013633875 6:112010284-112010306 GTCTTACAGTGGCAGGTGGAAGG + Intergenic
1014322012 6:119942145-119942167 GTGTGAAAGTAGCAAATGTTAGG + Intergenic
1015219480 6:130787833-130787855 GTGTGAGAGTAACCAGGGGAAGG - Intergenic
1018927372 6:168215608-168215630 GTGCGACAGTGGCAGGTGGTTGG - Intergenic
1019244683 6:170700710-170700732 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1020756789 7:12212576-12212598 GAGTGACAGCAACAAGTGGATGG + Intronic
1023104809 7:36753000-36753022 TTGTGACAGTAGTAAGAGGTGGG - Intergenic
1023326375 7:39062700-39062722 GTGTGACAGTGGTCATTGGAGGG + Intronic
1023468830 7:40490676-40490698 GAGTGACAGCAGCAAGATGAAGG - Intronic
1024477890 7:49833207-49833229 GTGTAACAGGAGGTAGTGGAGGG + Intronic
1024865613 7:53902490-53902512 GAGTATCAGTAGCAAGTAGATGG - Intergenic
1024908539 7:54418799-54418821 GGTTTACAGCAGCAAGTGGAAGG + Intergenic
1029136634 7:98377459-98377481 GTATGACAGTACCAAGTGTTGGG - Intronic
1029538461 7:101169406-101169428 GTGTGACAGGTGGAAGTTGAAGG - Intergenic
1029877429 7:103769226-103769248 GAGTGACAGTAGTAAGAGGTGGG + Intronic
1031765010 7:125767071-125767093 GTGAGACAGTAGAAGATGGAGGG + Intergenic
1033368380 7:140688415-140688437 GTGTGCCAGAAACGAGTGGAGGG + Intronic
1033804530 7:144938513-144938535 GAATGACAGTTGAAAGTGGAAGG + Intergenic
1034939429 7:155220770-155220792 ACGAGACAGTAGCAAGGGGAGGG + Intergenic
1035503444 8:107478-107500 GTGGGACAGTAGCAATTTGAAGG - Intergenic
1035650583 8:1261004-1261026 GTGTGACAGTGGCGTGAGGAGGG + Intergenic
1040564244 8:48551714-48551736 GTGTCACAGCAGCAAGAAGAAGG - Intergenic
1041641410 8:60206878-60206900 GTGGGAAAGGAGCAAGTAGATGG - Intronic
1041984569 8:63906847-63906869 GTTTGAAAGTATCAAATGGATGG + Intergenic
1047224772 8:122947014-122947036 GGGAGACAGAGGCAAGTGGATGG + Intronic
1047256695 8:123218763-123218785 GTGAGACAGAAGAATGTGGAAGG + Intergenic
1051359914 9:16272817-16272839 CTGTGCCAGTAGCAAGTCTAGGG - Intronic
1051979200 9:22993366-22993388 GTGTGAGAGAAGGAAGAGGAAGG + Intergenic
1052415160 9:28168365-28168387 GTGTGAAAATAGCAACAGGAAGG + Intronic
1052761459 9:32596503-32596525 GTGTCACAGTGGCAAGTGTCCGG - Intergenic
1053425605 9:38008087-38008109 ATGTGACAGGAGCACCTGGAGGG + Intronic
1055679433 9:78699736-78699758 GTGTGACAGGAGCAACCTGACGG + Intergenic
1056317814 9:85408382-85408404 GTGTGACAGTAACCTGGGGAGGG - Intergenic
1056542887 9:87589258-87589280 GTGTTTCAGTATCAAGTGGGAGG - Intronic
1058852444 9:109026022-109026044 GTGTGACAGTAGAGAATAGATGG - Intronic
1059658347 9:116377141-116377163 GTGTGACTGCAGCAGGCGGATGG - Intronic
1061734747 9:132646427-132646449 GTGAGAAAATAGTAAGTGGAAGG - Intronic
1061879356 9:133561039-133561061 CTCTGACCGTAGCAGGTGGAGGG + Intronic
1203698471 Un_GL000214v1:117248-117270 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203699389 Un_GL000214v1:123399-123421 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203700333 Un_GL000214v1:129682-129704 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203701255 Un_GL000214v1:135702-135724 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203474725 Un_GL000220v1:141332-141354 GTGGGACAGTATCAGGTGAAAGG + Intergenic
1203480082 Un_GL000224v1:4285-4307 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203481052 Un_GL000224v1:10613-10635 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203482015 Un_GL000224v1:16922-16944 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203416733 Un_KI270330v1:322-344 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203548581 Un_KI270743v1:150642-150664 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203549838 Un_KI270743v1:157763-157785 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203550777 Un_KI270743v1:163928-163950 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG + Intergenic
1203569680 Un_KI270744v1:119636-119658 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203604872 Un_KI270748v1:49930-49952 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1188284281 X:28309213-28309235 CTTTCACAGTAGCAAGTTGATGG - Intergenic
1189293714 X:39904069-39904091 CTGAGACAGTAGCTAGGGGAAGG + Intergenic
1192024799 X:67438159-67438181 GTGTCACAGAAGCCAGTGAAAGG - Intergenic
1195273484 X:103255259-103255281 GATTGACAGTATCAAGTGGAGGG - Intergenic
1195986790 X:110639078-110639100 GTGTGCCAGTAGCCACTGGCAGG - Intergenic
1197783178 X:130176533-130176555 GTGTTACATTATCAAGTGGATGG + Intronic
1199350877 X:146798342-146798364 GTGTGACAGTACCAAATGCCTGG + Intergenic
1200274392 X:154718020-154718042 GTGTGACAGCAGGAAGTGTGGGG + Intronic
1202387057 Y:24336326-24336348 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1202483729 Y:25333802-25333824 GTGGGACAGTAGCAATTTGAAGG - Intergenic