ID: 941108379

View in Genome Browser
Species Human (GRCh38)
Location 2:161389371-161389393
Sequence CATTAGGAGGTGAATCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941108379_941108382 4 Left 941108379 2:161389371-161389393 CCAGGCTGATTCACCTCCTAATG No data
Right 941108382 2:161389398-161389420 CGAATATGAGCACAGATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941108379 Original CRISPR CATTAGGAGGTGAATCAGCC TGG (reversed) Intronic
No off target data available for this crispr