ID: 941108382

View in Genome Browser
Species Human (GRCh38)
Location 2:161389398-161389420
Sequence CGAATATGAGCACAGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941108380_941108382 -9 Left 941108380 2:161389384-161389406 CCTCCTAATGTACACGAATATGA No data
Right 941108382 2:161389398-161389420 CGAATATGAGCACAGATTAAAGG No data
941108377_941108382 22 Left 941108377 2:161389353-161389375 CCTTTTTCTAATTCTCTACCAGG No data
Right 941108382 2:161389398-161389420 CGAATATGAGCACAGATTAAAGG No data
941108379_941108382 4 Left 941108379 2:161389371-161389393 CCAGGCTGATTCACCTCCTAATG No data
Right 941108382 2:161389398-161389420 CGAATATGAGCACAGATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941108382 Original CRISPR CGAATATGAGCACAGATTAA AGG Intronic
No off target data available for this crispr