ID: 941110946

View in Genome Browser
Species Human (GRCh38)
Location 2:161418164-161418186
Sequence ACATTGTTTACATATGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941110946_941110948 -1 Left 941110946 2:161418164-161418186 CCAGGGGCATATGTAAACAATGT 0: 1
1: 0
2: 0
3: 14
4: 155
Right 941110948 2:161418186-161418208 TATTTCTTTCTCTAGGAAATCGG 0: 1
1: 0
2: 6
3: 64
4: 763
941110946_941110947 -8 Left 941110946 2:161418164-161418186 CCAGGGGCATATGTAAACAATGT 0: 1
1: 0
2: 0
3: 14
4: 155
Right 941110947 2:161418179-161418201 AACAATGTATTTCTTTCTCTAGG 0: 1
1: 0
2: 11
3: 62
4: 732
941110946_941110950 15 Left 941110946 2:161418164-161418186 CCAGGGGCATATGTAAACAATGT 0: 1
1: 0
2: 0
3: 14
4: 155
Right 941110950 2:161418202-161418224 AAATCGGGTCTATATGCATCCGG 0: 1
1: 0
2: 0
3: 1
4: 41
941110946_941110949 0 Left 941110946 2:161418164-161418186 CCAGGGGCATATGTAAACAATGT 0: 1
1: 0
2: 0
3: 14
4: 155
Right 941110949 2:161418187-161418209 ATTTCTTTCTCTAGGAAATCGGG 0: 1
1: 0
2: 4
3: 50
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941110946 Original CRISPR ACATTGTTTACATATGCCCC TGG (reversed) Intronic
904828866 1:33294106-33294128 ACATTGGGTACCCATGCCCCAGG - Intronic
904997274 1:34640767-34640789 ACCTTGCTTCCATATGGCCCTGG + Intergenic
911181775 1:94867230-94867252 ACAGTTTTTACTTATGCACCTGG - Intronic
912239097 1:107886190-107886212 ACAATATTGACATATGTCCCAGG + Intronic
915435203 1:155900084-155900106 ACATGGTATACATATTCTCCTGG + Intronic
915695231 1:157734301-157734323 ACATTGTTTACATCTTCACTAGG - Intergenic
915876489 1:159616478-159616500 ACATTTTTTTCATATCCCCATGG + Intergenic
921784863 1:219218269-219218291 ACATTGTTTAAATATGTTCTTGG - Intergenic
922732481 1:227958279-227958301 ACATTCTTTTCAAATGCCCATGG + Intergenic
923195892 1:231666974-231666996 ACATTGTTTGAATATTCGCCTGG - Intronic
924772028 1:247087519-247087541 CCACTGTTTGCATCTGCCCCTGG - Intergenic
1063690510 10:8282609-8282631 ACATTGTTTTCTTCTGCCCCTGG + Intergenic
1064887867 10:20132288-20132310 ACATTCTTTACAAATGCACATGG - Intronic
1066655045 10:37690060-37690082 ACATTCTTTTCAAATGCCCATGG + Intergenic
1067040098 10:42946139-42946161 ACATTCTTTTCAAATGCCCGTGG + Intergenic
1069067085 10:63953533-63953555 ACATTGTTTTTATATTCCCAGGG + Intergenic
1070865700 10:79706993-79707015 ACAATGTTTACAGAAGACCCAGG + Intronic
1070879492 10:79845124-79845146 ACAATGTTTACAGAAGACCCAGG + Intronic
1071632602 10:87229214-87229236 ACAATGTTTACAGAAGACCCAGG + Intronic
1071646049 10:87361432-87361454 ACAATGTTTACAGAAGACCCAGG + Intronic
1074660026 10:115644073-115644095 ACTTTGTTTATATATTCACCAGG - Intronic
1079704517 11:23597328-23597350 ACATGGTTTTCTTATGGCCCTGG + Intergenic
1081393708 11:42560218-42560240 ACAATGTTTACAATAGCCCCAGG + Intergenic
1082961135 11:58919788-58919810 ACATTGTTCACAAATGGCTCAGG + Intronic
1086125032 11:83341487-83341509 ACATTTTTGACATATTCCCAAGG + Intergenic
1086809421 11:91288215-91288237 AAATTGGTTACATATGCACTGGG + Intergenic
1087254339 11:95937712-95937734 ACATTGTTTACTGATGGCTCTGG + Intergenic
1087308229 11:96508440-96508462 CCATTGTTTACCTAGGCCCTTGG - Intergenic
1088049655 11:105496852-105496874 ACTTTGTTGTCATATCCCCCTGG + Intergenic
1090622600 11:128574528-128574550 ACATTGTTAACATCTGCGTCAGG + Intronic
1093828588 12:23726608-23726630 TCATTGCTTATATACGCCCCTGG - Intronic
1093883959 12:24438394-24438416 ACATTCTGTACATGTACCCCAGG + Intergenic
1100102674 12:91127806-91127828 ACATAGTTCACATAAGCCCTTGG + Intergenic
1106826259 13:33524206-33524228 AGTTTTCTTACATATGCCCCTGG - Intergenic
1106856121 13:33854888-33854910 CCATAGTTTAGATATACCCCAGG + Intronic
1107749656 13:43551198-43551220 ACATAGTTTACATTTGTCCATGG + Intronic
1109281351 13:60359553-60359575 ACCTTGTTTTCAAATGCCCACGG + Intergenic
1110278234 13:73662382-73662404 TCATTTTTTACAAATGCCACTGG - Intergenic
1111045079 13:82804669-82804691 AAGTTGTTAAAATATGCCCCTGG + Intergenic
1111277049 13:85963760-85963782 ACTCTGTTTTCTTATGCCCCTGG - Intergenic
1120814861 14:88845461-88845483 ACATTCTATACATGTGGCCCAGG - Intronic
1123407246 15:20028443-20028465 CCTTTCTTTGCATATGCCCCTGG + Intergenic
1123516574 15:21035099-21035121 CCTTTCTTTGCATATGCCCCTGG + Intergenic
1123899235 15:24859500-24859522 ACATCTTTAACAAATGCCCCTGG - Intronic
1125299337 15:38237885-38237907 ACACTTTGTACATATGCCACCGG + Intergenic
1125833048 15:42729700-42729722 ACAAGGGTTACATCTGCCCCTGG + Intronic
1130663135 15:85847011-85847033 ACATTCTTTTCAAATGCACCTGG + Intergenic
1137307133 16:47213355-47213377 ACATTCTTTTCAAATGCCCATGG - Intronic
1138949223 16:61890566-61890588 ACATTGTTTACCTATGGCGGTGG + Intronic
1140586333 16:76296958-76296980 ACATTTTTAAAATATGCCCCTGG + Intronic
1141133999 16:81453916-81453938 ACATGGTTTACATGTGCGTCTGG + Intronic
1146500177 17:33357233-33357255 TCATTGTTCACATATGCACAGGG + Intronic
1148252606 17:46097600-46097622 ACATTGTTTAAATATTACACTGG + Intronic
1148978661 17:51551669-51551691 ACAATGTTTACATCTGTGCCTGG - Intergenic
1150207082 17:63417229-63417251 AATTTTTTTACCTATGCCCCAGG + Intronic
1150669411 17:67178157-67178179 ACATTTTATCCATATGCCACAGG - Intronic
1154971395 18:21413243-21413265 ACTTTGTTTCCATTTCCCCCAGG + Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156880738 18:42075353-42075375 ACATTATTTACTTAAGCCACTGG - Intronic
1156955602 18:42959151-42959173 ACAATGTTTACATATGAAGCTGG - Intronic
1157869679 18:51218558-51218580 ACATTCTAGACCTATGCCCCTGG - Intergenic
1158946317 18:62450070-62450092 ACATGGTTTACCTATGGCACAGG - Intergenic
1166625330 19:44346874-44346896 ACATTGTTTTCATGTGCTTCAGG - Intronic
929348866 2:40923102-40923124 ACAGTTTGCACATATGCCCCGGG - Intergenic
931079268 2:58751442-58751464 ACTTTGTAAACATATGCCCATGG + Intergenic
931310025 2:61069114-61069136 TCATTGTTTACATAAGACACTGG - Intronic
933205444 2:79502111-79502133 AGATTGTATACTTGTGCCCCAGG - Intronic
935692215 2:105742268-105742290 AAATTGTTTCCATTTGTCCCTGG - Intergenic
935879368 2:107545871-107545893 ACATTCTTTACAAATTCCCATGG - Intergenic
937728943 2:125203411-125203433 ACATTCTTTATATATGTCCCTGG - Intergenic
937949633 2:127374034-127374056 ACATTGTTTACTAATGGCTCTGG + Intronic
938631750 2:133175120-133175142 ACTTTTTTTTCATATGCCCAGGG + Intronic
941110946 2:161418164-161418186 ACATTGTTTACATATGCCCCTGG - Intronic
948334323 2:237195480-237195502 ACAGTGTTTTCATATGCCTCAGG - Intergenic
1169703042 20:8470297-8470319 ACATAGTTTCCATATGTCCCAGG - Intronic
1173368377 20:42410620-42410642 ACATTCTTTTCATGTGCCCCTGG + Intronic
1177424111 21:20900081-20900103 ATATTGTTTAAATTTGCCCAAGG + Intergenic
950709989 3:14807170-14807192 ACTTTGTTTTCAGAAGCCCCCGG + Intergenic
951344182 3:21525944-21525966 AAATTGTTAATATATGCCCAAGG - Intronic
953143507 3:40251121-40251143 ACATTTTCAACAAATGCCCCAGG + Intronic
953231871 3:41072459-41072481 AGCTTGCTTACATATGCTCCAGG + Intergenic
955959062 3:64320368-64320390 ACATTTTGCACATATACCCCTGG - Intronic
956674083 3:71718607-71718629 AAATTGTTGCCATGTGCCCCGGG + Intronic
960237691 3:115303191-115303213 ACAATGTTTTCATGTGCACCTGG + Intergenic
960548999 3:118952474-118952496 ACATTGTTCACATCTTCACCAGG + Intronic
960594240 3:119393289-119393311 ACCTTGTCTAGAGATGCCCCAGG - Intronic
962019711 3:131485900-131485922 CCATTGTTTACAGATGCTCTGGG - Intronic
964293958 3:155213142-155213164 ACATTGTTTACATTTGGGCAGGG + Intergenic
967136310 3:186515675-186515697 GCATTTTTCACATATACCCCAGG - Intergenic
969284711 4:6195918-6195940 ACTTTATTTACAAAAGCCCCTGG + Intronic
970694875 4:18665530-18665552 ACTTTGATTCCATATGCCACCGG + Intergenic
970836397 4:20413385-20413407 ACATTAATTCCATATGCACCTGG - Intronic
972455952 4:39255381-39255403 TCATTGTTTACATTTACCCGTGG - Intronic
973850674 4:54958474-54958496 ACATAGCTTAGATATTCCCCAGG + Intergenic
975355391 4:73396613-73396635 AAATTAGTTACATATACCCCAGG + Intergenic
975603611 4:76129538-76129560 ACATTATTTTCATAGGCTCCTGG + Intronic
975649428 4:76577855-76577877 ACAATGTTTCCATAAGCCCCAGG + Intronic
975960312 4:79896057-79896079 ACATTTTTTTCACATGCCCATGG - Intergenic
976378718 4:84375206-84375228 ACATAGTTCAGATAAGCCCCTGG + Intergenic
977965456 4:103142228-103142250 ACAACGTATACATATGCCACAGG - Intronic
978978956 4:114918185-114918207 AAAATGTTAAAATATGCCCCTGG + Intronic
979065628 4:116129015-116129037 ACATTCTTTACTTATGCCATTGG + Intergenic
980446436 4:132914865-132914887 ACATTTTTTACATATACTTCAGG + Intergenic
980736339 4:136894491-136894513 ACATTGCTTACATTGGCCACTGG - Intergenic
980784125 4:137530629-137530651 ACAGTGGTGATATATGCCCCTGG + Exonic
982174706 4:152694711-152694733 ACATTATTTAAATATTCTCCAGG - Intronic
982344523 4:154342557-154342579 ACAATGTTCACATCTTCCCCAGG + Intronic
983084276 4:163425234-163425256 AAATTGCTTACATATGGGCCAGG + Intergenic
983394725 4:167179376-167179398 ACAATGCTTACAAATGTCCCAGG + Intronic
987695372 5:21322099-21322121 ACATTGAATATAAATGCCCCTGG - Intergenic
989520738 5:42397093-42397115 ACAGTGCTAACACATGCCCCTGG + Intergenic
991745036 5:69730005-69730027 ACATTGAATATAAATGCCCCTGG + Intergenic
991752669 5:69825217-69825239 ACATTGAATATAAATGCCCCTGG - Intergenic
991796605 5:70309734-70309756 ACATTGAATATAAATGCCCCTGG + Intergenic
991802287 5:70381953-70381975 ACATTGAATATAAATGCCCCTGG - Intergenic
991824415 5:70605319-70605341 ACATTGAATATAAATGCCCCTGG + Intergenic
991831988 5:70700346-70700368 ACATTGAATATAAATGCCCCTGG - Intergenic
991888984 5:71309291-71309313 ACATTGAATATAAATGCCCCTGG + Intergenic
993849570 5:92989973-92989995 AGCTTGTTTTCATATACCCCAGG - Intergenic
994999813 5:107113040-107113062 ACACTGTTTACTTGTGACCCAGG - Intergenic
996256376 5:121409242-121409264 AGATTGTTTTCATCTGCCCCTGG + Intergenic
996406572 5:123111360-123111382 ACTTTGTTAACAAATGTCCCAGG + Intronic
997410156 5:133684838-133684860 TCATTATTTACAGCTGCCCCAGG - Intergenic
997447901 5:133955064-133955086 ACATTGATTAAAAATGCCCCTGG - Intergenic
997476171 5:134143753-134143775 GCCTTGTTTTCATAGGCCCCAGG - Intronic
997721853 5:136084414-136084436 ACAATGTTTAGACATGCTCCAGG - Intergenic
999475059 5:151890836-151890858 GCATTGTTAACATAACCCCCAGG - Intronic
999830036 5:155309935-155309957 ACATTCTTAACAAGTGCCCCAGG + Intergenic
1004754276 6:18594863-18594885 ATATTGTATACATATGACACAGG - Intergenic
1004754980 6:18601303-18601325 ACATAGTTCATATATTCCCCTGG - Intergenic
1005153830 6:22781143-22781165 ACATTGGTGCCTTATGCCCCTGG + Intergenic
1005636086 6:27754517-27754539 ACAGTTTTTCCAGATGCCCCAGG + Intergenic
1005663987 6:28030885-28030907 ACTTTGTTTTCATATGCACTGGG + Intergenic
1008312475 6:49993140-49993162 ACATTCTTTACATAAGCACATGG + Intergenic
1008330401 6:50238335-50238357 CCATTTTCTACATATGCCCCAGG + Intergenic
1012543115 6:100385498-100385520 ACAGTGATTACATGTGTCCCAGG + Exonic
1013411687 6:109889146-109889168 ACATTGTTCACAAATGGCTCAGG + Intergenic
1013587479 6:111592239-111592261 AAATTGTTTACTTATCCTCCAGG + Intronic
1014426107 6:121308487-121308509 ACATTGCCCAGATATGCCCCTGG + Intronic
1014503270 6:122221193-122221215 ACATTTTTTATATAAGCCCCTGG + Intergenic
1015058791 6:128936907-128936929 ACATTGATATCATATGCACCTGG - Intronic
1015797972 6:137032190-137032212 ACATTTCTTACATTTCCCCCAGG - Intronic
1026219195 7:68377674-68377696 AGATTGCTTAAATATGCCCAAGG - Intergenic
1027565725 7:79790757-79790779 ACATTATTTTCATATACCCTCGG + Intergenic
1027565731 7:79790915-79790937 ACATTATTTTCATATACCCTTGG + Intergenic
1028368350 7:90061232-90061254 ACATTGTTTTCACTTGTCCCTGG + Intergenic
1028516739 7:91685935-91685957 ACATTTTTTACATAAGCAGCTGG + Intergenic
1030037847 7:105423234-105423256 TCAGTATTTACATATGCCCCAGG + Intergenic
1030994200 7:116337964-116337986 ACATTGTTCACATCTGACTCAGG - Intronic
1031300386 7:120056476-120056498 ACATTGTTTACAAATGTCTTGGG + Intergenic
1032385436 7:131519615-131519637 ACATTGTTTACTTATGCCTTTGG - Intronic
1043717157 8:83501620-83501642 ACATTTTTTTCTTTTGCCCCTGG + Intergenic
1043919511 8:85965188-85965210 TCAGTGCTTTCATATGCCCCCGG - Intergenic
1057354825 9:94324336-94324358 ACAATGTTTACAGAAGACCCAGG - Intronic
1057710104 9:97432920-97432942 GCTTTGTTTGCATATGCCTCTGG + Intronic
1059919621 9:119144183-119144205 ATATTCTTTACAAATGCCCATGG - Intergenic
1188688400 X:33098594-33098616 ACATTGTTTACATATAACACAGG - Intronic
1190459187 X:50654309-50654331 ACAATGTTCACATAAGCCCTTGG + Intronic
1190576894 X:51848668-51848690 ACGTTGTTTTCATATGCCTGAGG - Intronic
1192151643 X:68716482-68716504 AAATGGTTTACGTATGCCCTGGG - Intronic
1192613983 X:72598463-72598485 ACATAGTTACCATATGACCCAGG + Intronic
1194862780 X:99024285-99024307 ACATTTTCTAAATATGCCACAGG + Intergenic
1195798486 X:108680391-108680413 ATATTGTTAAAATATACCCCTGG - Intronic
1198457702 X:136833434-136833456 ACAGTGTTTACAGATGCTCAAGG - Intergenic
1198681032 X:139182608-139182630 AAATTGTTCACATATTCCCTCGG + Intronic
1202195347 Y:22294928-22294950 ACAGAGTTTACATATGCTCAGGG - Intergenic
1202276534 Y:23126547-23126569 GCATTTTTAACATGTGCCCCAGG - Intergenic
1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG + Intergenic
1202429527 Y:24760269-24760291 GCATTTTTAACATGTGCCCCAGG - Intergenic
1202441264 Y:24909821-24909843 GCATTTTTAACATGTGCCCCAGG + Intergenic