ID: 941111340

View in Genome Browser
Species Human (GRCh38)
Location 2:161421608-161421630
Sequence TTCAGTAATCCCAAGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941111340 Original CRISPR TTCAGTAATCCCAAGTGGGT GGG Intronic
904163823 1:28540182-28540204 CTCAGTAATCCCGAGTAGCTGGG + Intergenic
904538339 1:31216011-31216033 TGCAGTAAACCCAAGTGGTCTGG + Intronic
906984314 1:50666584-50666606 TTAAGTAGTAACAAGTGGGTGGG + Intronic
907621465 1:55985352-55985374 TTTACTAATCCCATGTGGTTAGG + Intergenic
908440402 1:64147887-64147909 TTTGGTTATCACAAGTGGGTGGG + Intronic
911208227 1:95114183-95114205 GTCTGTAATCCCAAGTGCTTTGG - Intergenic
911732531 1:101305868-101305890 TTGAGAACTCCCAATTGGGTTGG - Intergenic
912604602 1:110976270-110976292 TTCAGGGATGCCAAGTGGCTGGG - Intergenic
914801241 1:150964179-150964201 TTCAGTAACCCCAAGTGCCTGGG + Intronic
916626196 1:166557961-166557983 TTCTGTGATCCCCAGTAGGTAGG + Intergenic
917127419 1:171699618-171699640 CTCAGTTCTCCCAAGTGGCTGGG - Intergenic
917355055 1:174118821-174118843 TCCAGCAATGCCCAGTGGGTAGG - Intergenic
922740836 1:228013516-228013538 GTCAGTAATCCCAGCTGGGCCGG + Intronic
1063233048 10:4085106-4085128 TCCTGTAATCCCAAGTAGCTGGG + Intergenic
1070910047 10:80110051-80110073 TTCAGTAATTGCAAGGGGGGTGG + Intergenic
1073247332 10:102100756-102100778 TGGAGTAATCCCAAGTAGCTGGG + Intergenic
1075010747 10:118867947-118867969 ATCTGTAATCCAATGTGGGTGGG + Intergenic
1080040356 11:27753631-27753653 TTTAGTACACCCAAGTGGGGTGG - Intergenic
1084187678 11:67483485-67483507 GTCAGTCATCACAAGCGGGTTGG + Intronic
1087376704 11:97351731-97351753 TTTAGAAATCCCAGGTGGGAGGG + Intergenic
1092188644 12:6500896-6500918 TACAGTAATACCAAGTAGATTGG + Intronic
1093183607 12:15994905-15994927 TGCAGTAATCCCAAGAGGGAGGG + Intronic
1093902991 12:24657734-24657756 CTGAGTAATCCCAAGTAGCTGGG + Intergenic
1097315544 12:58167192-58167214 ATCAGTCATTCCTAGTGGGTGGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107883707 13:44856119-44856141 TAGGGTAATGCCAAGTGGGTTGG - Intergenic
1109233857 13:59791920-59791942 TACAGCAATCCCCAGTGGCTAGG - Intronic
1111568761 13:90050345-90050367 TTCAGTAATCTCCAGTAGGATGG + Intergenic
1115255227 14:31393762-31393784 TCTTGTAATCCCAAGTAGGTGGG + Intronic
1116676420 14:47911731-47911753 TTCAGGAATACCAAGGAGGTTGG - Intergenic
1119333442 14:73812777-73812799 TTCTGTAGTCCCAAGTAGCTGGG - Intergenic
1125144869 15:36455426-36455448 TTCAGGTAACCCCAGTGGGTTGG - Intergenic
1130529325 15:84734323-84734345 TTCAGTAAAGACCAGTGGGTTGG + Intergenic
1131088273 15:89597406-89597428 CTCAGTAACCCCAAGTAGCTGGG - Intronic
1131130636 15:89897980-89898002 TACTGTAATCCCAAGTAGCTGGG - Exonic
1132392501 15:101449637-101449659 TTGAGCAACCCCATGTGGGTGGG + Intronic
1139175292 16:64680314-64680336 TTCAGAAAACGCAAGTGGGAAGG + Intergenic
1142530087 17:573545-573567 TTCAGGACTCCTATGTGGGTGGG - Intronic
1142998040 17:3772874-3772896 TCCAGTGACCCCAGGTGGGTGGG + Intronic
1146141646 17:30373461-30373483 TTCAGTAGTCACAAATGGGAAGG - Intergenic
1149781467 17:59399849-59399871 TTCATTCACCCCAGGTGGGTTGG + Exonic
1153374714 18:4362966-4362988 TCCAGTAATGCCAAGGGGATTGG - Intronic
1156113791 18:33761063-33761085 TTCAGCAATACCAATTGGCTGGG - Intergenic
1158411428 18:57209220-57209242 TCCAGGAATGCCAAGTGGGTCGG - Intergenic
1158692716 18:59675442-59675464 TTCAGTAGTCCCATGTGTGGGGG - Intronic
1159084788 18:63776313-63776335 TTTAGTTACCCCTAGTGGGTGGG - Intronic
1159390147 18:67782081-67782103 GTCAGTAATTCCAAGTGTGCTGG + Intergenic
1161687454 19:5710198-5710220 CTCAGTAATCCCGAGTAGCTGGG + Intronic
1163891264 19:20017384-20017406 AACAGTAAGCTCAAGTGGGTGGG + Intronic
1167223396 19:48218914-48218936 TTCAGTAATCTCAAGTTGAATGG + Exonic
1168660470 19:58161805-58161827 GTCAGAAATCCAAAATGGGTTGG + Intergenic
926806380 2:16715757-16715779 TTCAGGAACCCCTAGTGTGTGGG - Intergenic
927276841 2:21269156-21269178 TGCAGTAATAAGAAGTGGGTGGG - Intergenic
927320149 2:21734323-21734345 AGCAGTAAACCCAAGTGTGTTGG - Intergenic
929159426 2:38817021-38817043 ATCACTAATCAAAAGTGGGTGGG - Intronic
930540348 2:52698061-52698083 TTTAGTTATCACAACTGGGTGGG + Intergenic
932755442 2:74405135-74405157 CTCAGTAATCCCGAGTAGCTGGG - Intergenic
933184195 2:79260466-79260488 TTCAGCAAACCCAAGTGACTAGG - Intronic
933979858 2:87540653-87540675 TTCGCTAGCCCCAAGTGGGTGGG - Intergenic
935024248 2:99261226-99261248 TTAAGTAATGGCAAGTGGATTGG + Intronic
936313962 2:111410138-111410160 TTCGCTAGCCCCAAGTGGGTGGG + Intergenic
936929768 2:117776413-117776435 CTCAGGAATTCCTAGTGGGTGGG - Intergenic
937336101 2:121063285-121063307 TTCTGGAATCCCAAGGGGGAAGG + Intergenic
937730938 2:125228215-125228237 TACAGCAATCACAAGTTGGTAGG - Intergenic
938763877 2:134447688-134447710 AGCAGTCATCCCAAGTGGGAGGG + Intronic
940411650 2:153371045-153371067 TTTAATAATCCCAATTGTGTTGG - Intergenic
941111340 2:161421608-161421630 TTCAGTAATCCCAAGTGGGTGGG + Intronic
942304473 2:174592277-174592299 GTCTCTAATCCCAAGTGGGCAGG + Intronic
943442470 2:187942990-187943012 TTCAGAATTCCCAAGAGGGTTGG - Intergenic
943766373 2:191666783-191666805 CTCAGCTATCCCATGTGGGTGGG - Intergenic
945621009 2:212137067-212137089 TTCTATAATCTCCAGTGGGTTGG + Intronic
946619836 2:221548986-221549008 TACAGGACTCCCAAGTGGCTGGG - Intronic
1174143724 20:48435607-48435629 TTTAATGATCACAAGTGGGTTGG + Intergenic
1179106315 21:38403775-38403797 GTCAGAAATCCCACGTGGATGGG - Intronic
1180701802 22:17785258-17785280 GTCAGCAGTCCCAAGTCGGTGGG + Intergenic
1181302183 22:21888690-21888712 CTCAGCAATCCCAAGTAGCTGGG + Intergenic
1181416107 22:22760029-22760051 GCCTGTAATCCCAAGTGTGTTGG + Intronic
1182315557 22:29444554-29444576 TTCTGTAATCCCAAGTAGCTGGG - Intergenic
1185371106 22:50461364-50461386 ATGGGGAATCCCAAGTGGGTGGG + Intronic
951240421 3:20280306-20280328 TCAAGTCATCCCAAGTGGGCTGG + Intergenic
951993794 3:28704662-28704684 TTCTGTAACCCCAGGTGTGTGGG + Intergenic
952541648 3:34373409-34373431 TTCAGAAATCTCAAGAGAGTTGG + Intergenic
952868914 3:37879967-37879989 TTCAGTCATTCCAAGTGCTTGGG + Intronic
953401929 3:42630826-42630848 TTCAGTTTTCCAAAATGGGTCGG + Intronic
957020220 3:75118321-75118343 TTCCGTGAGCCCCAGTGGGTAGG + Intergenic
958994321 3:100884903-100884925 TACAGTCATCCCAGGTGGGGTGG + Intronic
959474784 3:106796465-106796487 TTCAGTAATCCCAGGGGTTTGGG + Intergenic
959556098 3:107720261-107720283 TTCAGGCATCTAAAGTGGGTAGG - Intronic
961195638 3:124999077-124999099 TTCAGGAACCCCATGTGGGGTGG - Intronic
961560578 3:127725963-127725985 TCCAGTGATCCCAAGTAGCTAGG - Intronic
966289454 3:178338414-178338436 TTGAGTAATCCCAGATGGCTAGG - Intergenic
967440505 3:189502392-189502414 TTAAGTGAAACCAAGTGGGTTGG + Intergenic
970289830 4:14560188-14560210 ATCAGTAATCCAAGGGGGGTTGG - Intergenic
974189703 4:58488856-58488878 TTCTGTAATCCCAAATAGGTAGG - Intergenic
975280219 4:72553487-72553509 TTCAGAAATCTCAAGTAGATGGG + Intronic
976314912 4:83648854-83648876 CTCAGTGATCCCAAGTAGCTGGG - Intergenic
976543975 4:86311744-86311766 TTCAGTAGTCCCAAGTGTTCTGG - Intronic
982936678 4:161486602-161486624 TTCAGTTACAACAAGTGGGTAGG - Intronic
988287116 5:29234475-29234497 TTCAGTTCTTCCAATTGGGTAGG - Intergenic
995922992 5:117335982-117336004 TTCAGTAATCTCAATTTGGTGGG + Intergenic
997890805 5:137674666-137674688 TGCAGAAAACCCAACTGGGTTGG - Intronic
1001890164 5:175331976-175331998 GTCAGTAAGACCAAGTGGTTGGG - Intergenic
1002147425 5:177195727-177195749 GTCAGTAATCCCAAGTACTTTGG - Intronic
1003185240 6:3824819-3824841 TTCAGAATTACCAAGTGAGTGGG - Intergenic
1004736279 6:18409508-18409530 TTCTGTCAACCCAAGAGGGTGGG - Intronic
1006771335 6:36555415-36555437 ATCTGCAATCCCCAGTGGGTAGG - Intergenic
1022457648 7:30572970-30572992 TTCTGTAATCCCCAGTAGGTAGG - Intergenic
1028775274 7:94669188-94669210 TTAAGTAATTTTAAGTGGGTGGG + Exonic
1028894728 7:96028404-96028426 TTCAGTAATGCCAAGTTAGGAGG + Intronic
1029670207 7:102024934-102024956 TTCAGGAGTCCAAAGTGGGATGG + Intronic
1029671565 7:102036080-102036102 TTGTGTAATCCCAAGTAGCTGGG + Intronic
1029910122 7:104137217-104137239 CTCAGTCTTCCCAAGTGGCTGGG + Intronic
1032344096 7:131104125-131104147 CGCAGGAATCCCAAGTGGTTTGG + Intergenic
1032887112 7:136152456-136152478 CTCAGTACTCCCAAGTAGCTAGG - Intergenic
1033408213 7:141091196-141091218 TTCAGTAATAACCATTGGGTAGG + Intronic
1033462250 7:141557490-141557512 AGCAGTAATCCTCAGTGGGTGGG - Intronic
1034785544 7:153922946-153922968 ATCAGTGATTCCAAATGGGTTGG + Intronic
1034951713 7:155301807-155301829 TTTAGTAATCTGAAATGGGTAGG - Intronic
1036732827 8:11281284-11281306 TTCTGTGATCCCAAATAGGTAGG - Intergenic
1039977251 8:42377516-42377538 TTCAGTAATCCTTTGGGGGTAGG + Intergenic
1040516545 8:48140095-48140117 TTCACTAATCAGAAGTGGTTTGG - Intergenic
1045138060 8:99245655-99245677 CTCAGTAATCCCAAGTAGCTGGG + Intronic
1047813578 8:128437083-128437105 TTCTGTAATGCCAAGTGAGGAGG + Intergenic
1061029445 9:128071038-128071060 GGCAGCAATGCCAAGTGGGTAGG - Intronic
1190851679 X:54250097-54250119 CTCAGTCATCCCCAGTTGGTCGG - Exonic
1191958602 X:66674046-66674068 TGCAGTAGTCCCTAGTGAGTAGG - Intergenic
1192019901 X:67377090-67377112 TGCAGCCATGCCAAGTGGGTGGG - Intergenic
1195938045 X:110143859-110143881 TTCTGTAAGCCCAAGAGGCTAGG + Intronic
1197713074 X:129686217-129686239 AGCAGTAATGCCTAGTGGGTAGG + Intergenic
1198123636 X:133620643-133620665 ATCAGTAATTCCAAAAGGGTGGG - Intronic