ID: 941111882

View in Genome Browser
Species Human (GRCh38)
Location 2:161425138-161425160
Sequence TATTCTATTTAGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941111882 Original CRISPR TATTCTATTTAGAAGGTGGG GGG (reversed) Exonic
904043216 1:27595988-27596010 TTGTCTATTTAGAAGGTGTTGGG + Intronic
906376027 1:45297369-45297391 TATGATATTTAGGTGGTGGGAGG + Intronic
906849750 1:49235611-49235633 TATTTTATATACAAGGTGGAAGG + Intronic
906987309 1:50697326-50697348 TATTGCTTTTAAAAGGTGGGGGG + Intronic
907840172 1:58149375-58149397 TATTCTATCTTGCAAGTGGGTGG + Intronic
909194092 1:72594124-72594146 TATTCTATCTAGAATGTGAGTGG - Intergenic
909229265 1:73064015-73064037 TGCTCTAGTTAGAAGGTGTGTGG + Intergenic
910296310 1:85649101-85649123 TAATATATTTTGAAGTTGGGTGG - Intergenic
914217283 1:145643611-145643633 TCTGCTATTTGGAAGCTGGGAGG - Intronic
914469852 1:147966296-147966318 TCTGCTATTTGGAAGCTGGGAGG - Intronic
914678393 1:149921314-149921336 TTTTCTTTTTTTAAGGTGGGAGG + Intergenic
914698052 1:150103914-150103936 TATTTTATTAAGAAGAAGGGAGG - Intronic
917558433 1:176117192-176117214 TATAATATTTTGAAGCTGGGAGG - Intronic
917877009 1:179294949-179294971 TTTTCTTTTTAAAAGTTGGGCGG + Intronic
918217976 1:182409689-182409711 TACTCAATTCAGAAGATGGGTGG + Intergenic
921654944 1:217723438-217723460 TAATCTATTTATAGGTTGGGTGG - Intronic
924059377 1:240155683-240155705 TACTAGATTTAGAAGGTGTGAGG + Intronic
1062782075 10:221829-221851 TATTTTATTTGGAGGGTGGAGGG + Intronic
1065242886 10:23725598-23725620 TATTCTACTTGGAAGGAAGGGGG - Intronic
1066171365 10:32850598-32850620 GATTCTATTTTGCATGTGGGAGG - Intronic
1067129069 10:43545148-43545170 GATTGTAGTAAGAAGGTGGGTGG - Intergenic
1071952062 10:90714665-90714687 TATTAGATTTTGGAGGTGGGTGG - Intergenic
1073385531 10:103124650-103124672 TAATTTTTTTAAAAGGTGGGGGG - Intronic
1073504262 10:103969911-103969933 TCTTGTAGTTAGAAGGTGGTAGG + Intronic
1075345650 10:121680275-121680297 TTTTATATTGAGATGGTGGGAGG - Intergenic
1078879737 11:15436385-15436407 GTTTTTATTTTGAAGGTGGGAGG + Intergenic
1081628795 11:44673352-44673374 TATTTTGTTTAGAAAGGGGGGGG - Intergenic
1082806799 11:57457012-57457034 TTTCCTATTCAGAAGATGGGAGG - Intergenic
1083338588 11:61944081-61944103 TAATTTATTTTGAAGGAGGGAGG - Intergenic
1083377409 11:62236268-62236290 CATTCTATTTAGAAACAGGGAGG - Intergenic
1085912957 11:80850406-80850428 TCTTCGATTTACAATGTGGGTGG - Intergenic
1087679218 11:101200496-101200518 TTTTCTATTCAGTAGGTGAGGGG - Intergenic
1088009332 11:104980303-104980325 GAATCTATTTAGAACTTGGGAGG + Intergenic
1088734755 11:112719494-112719516 TATTCCCTTTGGAAGGTGAGGGG + Intergenic
1088980125 11:114855080-114855102 TAAACTATTCAGGAGGTGGGGGG - Intergenic
1090161855 11:124503636-124503658 TATTCTATTTTGGAGGAGGGAGG + Intergenic
1092701458 12:11235646-11235668 TTATTTATTTAGAAGGTGAGAGG - Intergenic
1093790329 12:23242556-23242578 TATTTTATTTATTAGGTGGTGGG + Intergenic
1095256900 12:40048906-40048928 TTTTCTATTTAGTAGGTCTGAGG - Intronic
1099338455 12:81395823-81395845 GATTCTTTTTGGAAGCTGGGTGG - Intronic
1101787426 12:107897142-107897164 TATTTTATTTATAAGGTTGATGG + Intergenic
1105333948 13:19446472-19446494 TAATCTAATTGGAAGTTGGGGGG - Intronic
1105845610 13:24291397-24291419 TTCTCTATTTAGAAGGGGTGAGG + Intronic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1106715262 13:32381877-32381899 TGTTGTATTTTGAAGGTAGGGGG + Intronic
1108890844 13:55257181-55257203 TACTCCAGTTAAAAGGTGGGAGG + Intergenic
1109667263 13:65555776-65555798 TGTTTGATTTAGAAAGTGGGAGG - Intergenic
1109974694 13:69815851-69815873 TTTTATATTTAGATGGTTGGAGG - Intronic
1110661987 13:78067279-78067301 CATTCTATTTAGAATCTGGATGG + Intergenic
1111680090 13:91431398-91431420 TATACTATTAAGAAGGTAGTAGG - Intronic
1114723994 14:24914527-24914549 TATTTTATTTAGGAAGGGGGAGG - Intronic
1115269665 14:31537738-31537760 TCTTCTGTTTAGAACGTTGGTGG + Intronic
1122724672 14:103742350-103742372 TATTCTCTTGGGAATGTGGGTGG - Intronic
1125642862 15:41246224-41246246 TCTTCTTTGTAGAAAGTGGGTGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131166708 15:90147105-90147127 TATTCTATTTAGACTGAGTGTGG + Intergenic
1134354503 16:13468485-13468507 TATTATATTTAAAAAGTTGGAGG - Intergenic
1134619948 16:15680277-15680299 TACTATATTCAGAATGTGGGGGG + Intronic
1139109929 16:63877651-63877673 TTTTCTAAACAGAAGGTGGGTGG + Intergenic
1140712937 16:77695117-77695139 TTTTCTTTTTAGGGGGTGGGTGG + Intergenic
1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG + Intergenic
1142051455 16:87960710-87960732 CATTGTATTTTGAAGTTGGGTGG + Intronic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1143359343 17:6355293-6355315 TATTTTATTTTCAAGGTGGAGGG + Intergenic
1146264651 17:31444353-31444375 TTTTCTCTTTAGAAGGGTGGGGG - Intronic
1147497041 17:40926652-40926674 TATTCTATTTGAAAGCTGGTGGG - Intronic
1149010620 17:51853008-51853030 CATTCTATTTAGAAATAGGGGGG + Intronic
1150160029 17:62889605-62889627 TATTCTATGGAGAAGGGTGGTGG + Intergenic
1153756308 18:8287135-8287157 TATAGTATTTGGAAGTTGGGTGG - Intronic
1154082727 18:11274226-11274248 GATTCTATTTGTAAGGTGTGCGG - Intergenic
1154171178 18:12052007-12052029 AATTCTATTTAAAAGGGGGGAGG - Intergenic
1158302433 18:56066569-56066591 TATTCTGTTTATTGGGTGGGGGG + Intergenic
1159424901 18:68272411-68272433 TTTTCTATGTGGGAGGTGGGGGG + Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164897230 19:31887649-31887671 TACTCTTTTTGGAAGGTGGGTGG - Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
927452792 2:23223381-23223403 AAGTCTATTTAGATGCTGGGTGG - Intergenic
929172119 2:38942715-38942737 TATTTTTTTTATAAGGAGGGGGG - Intronic
930198157 2:48529628-48529650 TCTCCTAATTACAAGGTGGGGGG + Intronic
931450894 2:62366786-62366808 TATTCTATGGAGAAGGCAGGGGG - Intergenic
933133288 2:78699996-78700018 TATTCAATCTAGTAGGTGGGAGG - Intergenic
936508863 2:113129788-113129810 TATTCAAGTTTGAAGCTGGGAGG + Intronic
938137592 2:128771755-128771777 TATTCTAATTTGGAGGTGAGGGG + Intergenic
938254814 2:129848577-129848599 CATTCTATTTAAAAAGTTGGGGG + Intergenic
938770082 2:134494162-134494184 TATTCTGTTTAGAAGTTGGTAGG + Intronic
941111882 2:161425138-161425160 TATTCTATTTAGAAGGTGGGGGG - Exonic
941536244 2:166725222-166725244 TGCTCTTTTTAGAAGCTGGGGGG + Intergenic
941577564 2:167252622-167252644 GATTTTATTTGGAAGGAGGGAGG + Intronic
941870970 2:170385259-170385281 TCTTCTTTCTAGAAGTTGGGAGG + Intronic
942826252 2:180180441-180180463 AATTTTTTTTAGAAGGTGGGGGG - Intergenic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
947116136 2:226773062-226773084 TATTCTCTTTAGAAGTTCTGTGG - Intronic
1168903202 20:1383414-1383436 TATTTTATTTTGAAGGTTTGGGG - Intronic
1169519873 20:6359517-6359539 TATCCTGTTTGGAAGGTGGTGGG + Intergenic
1170663673 20:18366416-18366438 TATTAGATTTAGTGGGTGGGGGG - Intergenic
1170697960 20:18676987-18677009 TTTTCTTTTTAGGGGGTGGGAGG - Intronic
1172382109 20:34503289-34503311 TATTTTAATTAGAAGGGGGCAGG - Intronic
1178189957 21:30268879-30268901 TCTTCAAATCAGAAGGTGGGAGG - Intergenic
1178858375 21:36269030-36269052 TTTTCTTTTTAGGAGGTGGTGGG - Intronic
949203044 3:1403813-1403835 TATTTTATTTTGAAGTAGGGTGG - Exonic
956429614 3:69172604-69172626 TAATATATTTAGAAGGTGGCAGG + Intronic
956514913 3:70035928-70035950 AATTATAGTTAGAAAGTGGGAGG + Intergenic
957013662 3:75037742-75037764 TATTATAGTTTGAAGTTGGGTGG + Intergenic
959833985 3:110896905-110896927 GATTCTAATAAGAATGTGGGTGG - Intergenic
963413330 3:144960924-144960946 TATTATATTTTCAAGATGGGAGG - Intergenic
963774809 3:149427966-149427988 AATTCTATATAGAAGATGGCAGG - Intergenic
964531973 3:157678560-157678582 TATTCTCTTTAGAAAGTGCCAGG + Intergenic
968327802 3:197835548-197835570 TTTTCTATTTTGAAAGTGGGAGG - Intronic
970181407 4:13399944-13399966 TTTTCTACTTAGAATGTGGAAGG - Intronic
970542590 4:17094757-17094779 CGTTCCATTTAGGAGGTGGGAGG - Intergenic
972145398 4:36018666-36018688 TGTTCTATTTAGATGGAAGGTGG - Intronic
972770561 4:42193463-42193485 AATCCTATTCAGAAGATGGGAGG + Intergenic
973948347 4:55984257-55984279 TAGTCTATGTAGAAGGCTGGTGG - Intronic
975358347 4:73435009-73435031 CATTTTTTTTAGAGGGTGGGAGG + Intronic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
977611932 4:99044495-99044517 TATTATATGTAGAATGTGTGAGG + Intronic
978126567 4:105143406-105143428 TTTTCTATTCTGCAGGTGGGAGG + Intergenic
981909365 4:149960474-149960496 TATTCTATTTAGAAAGAGAAAGG - Intergenic
982824702 4:159987759-159987781 TATGCAATTTATAAGGTAGGTGG + Intergenic
984684910 4:182656455-182656477 AACTCTATTTACAAGGAGGGAGG + Intronic
985270459 4:188189888-188189910 TATTCTATTTTTAAGGTGAGAGG + Intergenic
985478708 5:93957-93979 CATTCTGTTTGGAAGGAGGGAGG - Intergenic
987042732 5:14077997-14078019 AATGCTGTTTAGAAGCTGGGTGG + Intergenic
987264211 5:16235443-16235465 TTTTCTATTTAGAAAGTGAGTGG - Intergenic
987852971 5:23381128-23381150 TATTATAGTTTGAAGTTGGGTGG - Intergenic
988801634 5:34701386-34701408 TAATCTCTTTAGAATTTGGGAGG - Intronic
995728573 5:115210179-115210201 TTTTTTTTTTAGAAGGTAGGAGG - Intergenic
998850713 5:146348236-146348258 AATTCTATTCAGAAGGAGGTGGG - Intergenic
999909360 5:156180803-156180825 GATTCTCTTTGGAAGCTGGGTGG + Intronic
1001661722 5:173398169-173398191 TTTTTTATTTAGAGGCTGGGTGG + Intergenic
1001861704 5:175061480-175061502 TAATCTATTGGGAAGGTGGGTGG - Intergenic
1004817687 6:19330539-19330561 TATTCTTTTTAAAATGGGGGTGG + Intergenic
1005248502 6:23916403-23916425 TATTTAAATTAGAAGGTGGCAGG - Intergenic
1005442863 6:25889980-25890002 GATTCTATGTGGAAGATGGGTGG + Intergenic
1006270437 6:32961706-32961728 TAGTATATTTTGAAGTTGGGTGG - Intronic
1007678649 6:43618945-43618967 TATTTTATTTATAAATTGGGGGG + Intronic
1009023516 6:57970685-57970707 AATTCTATACAGAAGGAGGGTGG + Intergenic
1009199088 6:60722250-60722272 AATTCTATACAGAAGGAGGGTGG + Intergenic
1011973975 6:93268836-93268858 TATTCTATTTTTAAGATGAGTGG + Intronic
1015186369 6:130421000-130421022 GATTCTTTTTGGAAGGTGGAAGG - Intronic
1015893439 6:137992490-137992512 TATGCTTTTTATAAAGTGGGTGG - Intergenic
1017274713 6:152553028-152553050 TCTTCTATTTAGAATGTATGTGG + Intronic
1017389082 6:153918862-153918884 CATTCTAATTAGAAAGAGGGGGG - Intergenic
1017723322 6:157259333-157259355 TATTCTGTTGAGATGGTGGAAGG + Intergenic
1019699072 7:2464286-2464308 TTTTTTTTTTAGATGGTGGGGGG + Intergenic
1020947784 7:14636267-14636289 TATTCTAATTATATGGTCGGGGG - Intronic
1021406601 7:20275228-20275250 TACTCTCTTGAGAATGTGGGAGG - Intergenic
1023053807 7:36275808-36275830 TATTCTTTTCAGAAAGAGGGAGG + Intronic
1023847174 7:44128901-44128923 TATTCTATTTTGGAGCTGTGTGG + Intergenic
1024356583 7:48419511-48419533 TACTCTTTTCAGAAGGTGGTGGG - Intronic
1024474654 7:49797924-49797946 TATTCTATGTAAAATGTAGGTGG + Intronic
1027887589 7:83929343-83929365 TATTATAAGTAGAAGGTAGGTGG - Intergenic
1031153508 7:118082390-118082412 TATTCTAGTTAGAGGGTAGAGGG - Intergenic
1031962980 7:128006405-128006427 TGTCCTATTTGGGAGGTGGGGGG - Intronic
1032023968 7:128426777-128426799 TATTCTATTTACTATGTGGTAGG + Intergenic
1032714193 7:134490666-134490688 TGGTTTATTTAGCAGGTGGGTGG - Intergenic
1034172967 7:149077325-149077347 TATTAGATTAAGAAGATGGGTGG + Intronic
1035359142 7:158298817-158298839 TTTACTTTTTTGAAGGTGGGAGG - Intronic
1036029611 8:4954020-4954042 AATTCTTTTTAACAGGTGGGTGG - Intronic
1038641271 8:29331008-29331030 TATACAATTTGGAAAGTGGGAGG - Intergenic
1039688299 8:39833235-39833257 TTTTCTATTTATAAGATGGACGG - Intronic
1039721460 8:40168935-40168957 TTTTCTATTGAGAAGGTGCTTGG + Intergenic
1040839744 8:51772415-51772437 TAAACTATTTTGAGGGTGGGTGG + Intronic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1044490146 8:92803975-92803997 TATTCTACTTAGAAGGTTTAGGG + Intergenic
1045804560 8:106143430-106143452 TATTCTCTTTAAAAGTTAGGTGG + Intergenic
1046303463 8:112329423-112329445 TATTTTTTCTAGAAGGTGGGGGG - Intronic
1047595050 8:126369998-126370020 TTTTCTATTAAGAAAGTGAGAGG + Intergenic
1047828222 8:128602342-128602364 TATTTGTTTTAGAAGTTGGGTGG - Intergenic
1050117118 9:2274681-2274703 TATTATATTTAAAAAGTGGGTGG + Intergenic
1051004879 9:12331559-12331581 AATTGAATTTAGAAGGTGGCAGG + Intergenic
1056633031 9:88309025-88309047 TATTCTGGTTGGAAGGTGGTGGG - Intergenic
1056901936 9:90607930-90607952 CATTCTATCTGGAAGGTTGGCGG - Intergenic
1059261943 9:112985532-112985554 TCTGCCATTTAGAAGCTGGGTGG + Intergenic
1060319720 9:122546208-122546230 GAGTCTATTTTGAATGTGGGAGG + Intergenic
1060600962 9:124877073-124877095 TATTTTATTTTCAAGGTGGAGGG + Exonic
1186187417 X:7035132-7035154 ACTTCTATACAGAAGGTGGGTGG - Intergenic
1188132731 X:26457695-26457717 TATTCTATTTACAAGTAGGGAGG - Intergenic
1190289721 X:48984219-48984241 TATTCTATCTGGAAGGAAGGAGG - Intronic
1192487889 X:71546332-71546354 TATTGTATTTAGAAGGTTTCAGG + Intronic
1193662080 X:84269565-84269587 TAATATATGTTGAAGGTGGGAGG + Intergenic
1197798497 X:130323469-130323491 AAATCTGTTTAAAAGGTGGGAGG + Intergenic