ID: 941111946

View in Genome Browser
Species Human (GRCh38)
Location 2:161425959-161425981
Sequence CAGGCTGCCCATATTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941111946 Original CRISPR CAGGCTGCCCATATTGGAGT GGG (reversed) Intronic
903938898 1:26915127-26915149 GAGGCTGCCAATATTAGAGTGGG - Intronic
904604254 1:31690331-31690353 CTGGCTGCCCAGATCGGGGTGGG - Intronic
905345563 1:37308931-37308953 CTGGCTGCCCATCTTGGAACAGG + Intergenic
906156039 1:43614507-43614529 CAGGCTGCCCATCTAGGAAGGGG + Intronic
906264189 1:44416576-44416598 CACTCAGCCCAGATTGGAGTTGG + Intronic
909302733 1:74033866-74033888 CAGGGTGTCCATTTTGAAGTAGG - Intronic
910146227 1:84083976-84083998 CAGGGTGCCCATATTCCAGAAGG + Intronic
912400110 1:109383617-109383639 CAGACTGCCCATCTAGGATTAGG + Intronic
914330716 1:146668090-146668112 CAGCCTGTCCAGATGGGAGTTGG + Intergenic
914879407 1:151535987-151536009 CAGGCTGGCCATATCTGAGGTGG - Intronic
917794208 1:178521160-178521182 CAGGCTGCCCTTCTTGGACCAGG + Intronic
918012779 1:180603265-180603287 CAGGCTGCCCATTTTCCAGTGGG + Intergenic
919640349 1:200039713-200039735 CATGCTGCCCAAAGTGGAGACGG + Exonic
922368292 1:224886315-224886337 AAGGTTGCCCATAGTGGAGAAGG - Intergenic
1067337594 10:45377700-45377722 CAGACTACCCATCTTGGAGGGGG - Intronic
1067569104 10:47358817-47358839 CAGCCTGCCCATCTAGGACTGGG + Intergenic
1069217997 10:65846135-65846157 CAGGCTTAACATAATGGAGTTGG - Intergenic
1070964120 10:80519072-80519094 CAGGCTGGCCATCTTGGGCTGGG - Exonic
1070967549 10:80538729-80538751 CCAGCGGCCCTTATTGGAGTCGG + Intronic
1074018873 10:109563564-109563586 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1075339103 10:121631388-121631410 CAGGCTTCCCATCCTGGAGAAGG + Intergenic
1077679270 11:4224089-4224111 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1077688703 11:4320731-4320753 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1079112763 11:17614148-17614170 GAGGATGCCCATATGGGGGTGGG - Intronic
1081789793 11:45774622-45774644 CAGGCTGCCCATTTTTCAGAGGG - Intergenic
1083194156 11:61072975-61072997 CATGCTCCCCATCTGGGAGTTGG + Intergenic
1084933628 11:72575552-72575574 CAGTCTGCCCATCTTGGACTGGG + Intergenic
1085043354 11:73339743-73339765 CAGCCTGCCCCTCCTGGAGTGGG + Intronic
1086550052 11:88044394-88044416 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1089648609 11:119896828-119896850 GAGGCTGAGCATATTAGAGTTGG + Intergenic
1093024174 12:14231804-14231826 AAGGTTGCCCATAGTGGAGAAGG - Intergenic
1094316206 12:29139506-29139528 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1094476338 12:30843520-30843542 CAGGCTGGACATAGTGGAGAGGG + Intergenic
1099349040 12:81541868-81541890 CAGGCTTCTCATATTGGAGTTGG + Intronic
1101473535 12:105021762-105021784 CAGAAGGCCCATACTGGAGTTGG + Exonic
1101673438 12:106897313-106897335 TTGACTGCCCATAGTGGAGTTGG + Intergenic
1103153521 12:118663293-118663315 CAGTCTGCCCCTACTGGGGTGGG + Intergenic
1107823943 13:44310758-44310780 CAGGGTGCCCATTTGGGACTGGG - Intergenic
1109537357 13:63738420-63738442 AAGGCCGCCCATTTTGGGGTGGG - Intergenic
1109546021 13:63839656-63839678 AAGGCTGCCCATTTTGGGGTGGG + Intergenic
1114531079 14:23396898-23396920 CAGGCTGCCCTGATGGGAATGGG - Intronic
1114536434 14:23425899-23425921 CAGGCTGCCCTGATGGGAATGGG - Intronic
1121430115 14:93880524-93880546 CAGGCTGCCCATTCTGTGGTTGG + Intergenic
1122414887 14:101544625-101544647 AGGGCTGCCCAATTTGGAGTGGG + Intergenic
1122429154 14:101628993-101629015 CAGGGTGGCCATCATGGAGTGGG + Intergenic
1124610696 15:31206525-31206547 CAGGCTGCTCATTTTGTAATTGG - Intergenic
1130872917 15:87985524-87985546 GAGGCGGCCCATACTGAAGTTGG - Intronic
1131615999 15:94018022-94018044 CAGCCAGCCCAGATTGGAGCTGG + Intergenic
1132728987 16:1351515-1351537 CACGCTGGCCATGTGGGAGTTGG - Exonic
1138548657 16:57735297-57735319 CAGGCCTTCCATCTTGGAGTGGG - Intergenic
1140002836 16:71042813-71042835 CAGCCTGTCCAGATGGGAGTTGG - Intronic
1142027839 16:87824019-87824041 AAGGCTGCCCAGAATGGGGTAGG + Intergenic
1146906086 17:36618680-36618702 GAGGCTGCGCAGGTTGGAGTTGG - Intergenic
1148337788 17:46852671-46852693 CAGGCTGTACATATTGGAGTTGG - Intronic
1149417895 17:56479466-56479488 CAGTATGCCCAGATTGAAGTAGG + Intronic
1151113470 17:71705789-71705811 CAGGCTCATCATATTGGAGCAGG + Intergenic
1153760010 18:8321609-8321631 CAGTCTGCCCTTAATGGAGAAGG + Intronic
1155941396 18:31805018-31805040 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1156490241 18:37491759-37491781 CACGCTGCCCATGTCGGAGAGGG - Intronic
1161711061 19:5848295-5848317 AAGGTTGCCCATAGTGAAGTAGG - Intronic
1164748197 19:30631288-30631310 CAGGCTGCCCCTCTTTGTGTCGG + Intronic
1165756066 19:38293666-38293688 GAGACAGTCCATATTGGAGTTGG - Intronic
1166903003 19:46080845-46080867 CAGGCTGCCCATTGGTGAGTGGG + Intergenic
1167249017 19:48391013-48391035 CGGGCTGCCCAGATTGGGGCTGG + Intronic
926695370 2:15766906-15766928 AAGGCTGCCCATCTGGGATTTGG + Intergenic
928829308 2:35460088-35460110 CAGGTTGTCCAGAATGGAGTTGG - Intergenic
931928255 2:67098749-67098771 CAGTCTGCCCCTATTGGGGAGGG - Intergenic
932818981 2:74883436-74883458 CAGGCTGCCCATTGTGGAGAGGG + Intronic
937335302 2:121058792-121058814 AAGGCTGCCCATAGGGGTGTCGG - Intergenic
938453162 2:131442112-131442134 CTTGTTGCCCATGTTGGAGTGGG + Intergenic
939162803 2:138609398-138609420 CAGGATTCCCATCTTGGTGTTGG + Intergenic
941111946 2:161425959-161425981 CAGGCTGCCCATATTGGAGTGGG - Intronic
941997463 2:171614118-171614140 CAGTCTGCCCATGTTTCAGTGGG - Intergenic
944189779 2:196990755-196990777 CATGCTACCCAGATTGGAGAGGG + Intronic
946033007 2:216719946-216719968 CAGAATGCCCATCTTGGAGCAGG + Intergenic
1168739197 20:173753-173775 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1168975494 20:1962593-1962615 CAGGCTACCCATAGTGTCGTCGG - Intergenic
1169289925 20:4340863-4340885 CAGGCTGCCCACAGTGGTGATGG + Intergenic
1172310201 20:33912256-33912278 CAGGCTGGCCTAGTTGGAGTTGG + Intergenic
1173478768 20:43382948-43382970 CAGGATGCTCATTTGGGAGTGGG - Intergenic
1179650521 21:42805520-42805542 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1181952152 22:26562244-26562266 CAGTCTGCCCATATGCGAGAAGG + Intronic
1183109385 22:35637766-35637788 CAGGCTTCCCAGGCTGGAGTGGG - Intronic
1183669004 22:39261208-39261230 CAGGCTGCACAGAGTGGAGCAGG + Intergenic
1184543029 22:45142446-45142468 GACGCTGCCCATATTGGTTTGGG + Intergenic
951055491 3:18142238-18142260 CAGGCTGCCTATATGGATGTGGG + Intronic
953332074 3:42062020-42062042 AAGGCTGCCCATTTGGGAGAAGG + Intronic
956398286 3:68848793-68848815 CAGCATGACCATCTTGGAGTGGG + Intronic
958904225 3:99924309-99924331 TAGGCAAACCATATTGGAGTTGG - Exonic
960868059 3:122222059-122222081 CTTTCTGCCAATATTGGAGTAGG + Intronic
963775365 3:149433694-149433716 CAGGCTGCCCAGATTCAAGGTGG - Intergenic
965862129 3:173160401-173160423 AAGGCTGCCCATAGTGAAGAAGG + Intergenic
967241173 3:187441160-187441182 TAGGCTGTACAAATTGGAGTTGG - Intergenic
968133044 3:196203366-196203388 CATGCTGCCCATTTTACAGTTGG + Intronic
968876120 4:3268874-3268896 CAGGCTGCCGACATTGCAGGAGG + Intronic
972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG + Intergenic
975669747 4:76768954-76768976 CAATCTGCCTATCTTGGAGTCGG - Intronic
975938691 4:79613791-79613813 AAGGCTGCCCAGAATCGAGTGGG + Intergenic
976558421 4:86475816-86475838 AAGGCTGCCCATAGTGAAGGAGG - Intronic
976959154 4:90945569-90945591 CAGGCTGCAAATATTGTATTCGG - Intronic
980714223 4:136611143-136611165 AAGGTTGCCCATAGTGGAGAAGG - Intergenic
980964431 4:139507077-139507099 GAGGCTGCCCTCAGTGGAGTTGG - Exonic
983883919 4:172960879-172960901 AAGGCTGCCCATAGTGAAGGAGG + Intronic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
988063163 5:26199940-26199962 CAGGCTGCCCATATTGGTGATGG + Intergenic
989081394 5:37625824-37625846 CAGCCTGCCCATATTTTAATTGG + Intronic
991290046 5:65024786-65024808 CACGTTGCCCATAATGGAGATGG - Intergenic
993671309 5:90764623-90764645 TAGGCTGCCCATAAGGGAGGGGG - Intronic
996358780 5:122623366-122623388 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
997157083 5:131572710-131572732 AAGGTTGCCCATAGTGGAGAAGG - Intronic
1000126265 5:158246820-158246842 CAAGCTGCCCATTTTGAATTTGG + Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000885480 5:166743581-166743603 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1002308395 5:178297741-178297763 CTTGCTGCCCAGATTGGAGCTGG + Intronic
1007272632 6:40650013-40650035 CAGGCTGCCCTTATTGCCTTGGG - Intergenic
1008476372 6:51939391-51939413 AAGGCTGCCCATAGTGAAGGAGG - Intronic
1009856302 6:69268796-69268818 CGGCCAGCCCATTTTGGAGTGGG - Intronic
1010071877 6:71753048-71753070 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1015003771 6:128253073-128253095 CTGTCTGCCTATATTGGAATTGG - Intronic
1017304735 6:152903902-152903924 CAGGCAGTCCATATTGGACCAGG - Intergenic
1021393466 7:20121817-20121839 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1021818050 7:24467391-24467413 CAGGGTGCCCATTTTAGAGATGG + Intergenic
1022488661 7:30799994-30800016 TGGGCTGCCCATCCTGGAGTGGG + Intronic
1023631194 7:42166079-42166101 CAGGCTGGGCAGTTTGGAGTTGG - Intronic
1026049597 7:66933891-66933913 CAGGATGCCCTAATTGGAGTTGG + Intronic
1028867057 7:95725612-95725634 CAGGCTGCACATAAAGGAGCTGG - Intergenic
1029500063 7:100923378-100923400 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1031665761 7:124480702-124480724 CAGGCGGCCCATCTTGGTGACGG - Intergenic
1032570454 7:132990456-132990478 CAAGCTGCCCATCTTGGATGGGG - Intronic
1033127811 7:138720378-138720400 CAGCCTGCTCATGTTGGAGGTGG + Intronic
1038780197 8:30563591-30563613 CAGCCTCCCCAGATTGGAGAAGG + Intronic
1046800218 8:118418357-118418379 CTGGCTGCACACATTTGAGTTGG - Intronic
1047777342 8:128083864-128083886 GTGGCTGCCCAAATTAGAGTGGG - Intergenic
1048931313 8:139317512-139317534 CAGGCTGCCAGTTTTTGAGTGGG - Intergenic
1049569702 8:143363531-143363553 CAGGCTGCCAAGAGTGGAGGAGG - Intergenic
1057198950 9:93130267-93130289 CAGGCTGCACATGTTGGGGCTGG + Intronic
1061477968 9:130881667-130881689 CAGCCAACCCATATTGGAGGTGG + Intronic
1187087003 X:16051192-16051214 GAGGCTGGCCATGTTGGAGATGG + Intergenic
1188201161 X:27293997-27294019 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1189131252 X:38500161-38500183 CTGGCTACCCAAATTGGAGCTGG + Intronic
1195538895 X:106039916-106039938 CCCGCTGCCCATATTGAAGAAGG + Intergenic
1196992852 X:121347485-121347507 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1198332309 X:135633107-135633129 CACCCTGCCCATTGTGGAGTTGG + Intergenic
1198788045 X:140313114-140313136 CAGGCTGCCACTGTTGGGGTGGG - Intergenic
1200812661 Y:7501600-7501622 AAGGCTGCCCATAGTGAAGGAGG - Intergenic