ID: 941113123

View in Genome Browser
Species Human (GRCh38)
Location 2:161439742-161439764
Sequence GCACCCCGCCTGGCTAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941113123_941113135 17 Left 941113123 2:161439742-161439764 CCAGCCTTAGCCAGGCGGGGTGC No data
Right 941113135 2:161439782-161439804 ACTTGGGAGGCTGAGGTGGGAGG 0: 8282
1: 20265
2: 64844
3: 127749
4: 200926
941113123_941113127 0 Left 941113123 2:161439742-161439764 CCAGCCTTAGCCAGGCGGGGTGC No data
Right 941113127 2:161439765-161439787 CTGTAGTAGTCCCAGCTACTTGG 0: 40
1: 78
2: 297
3: 5261
4: 88283
941113123_941113131 10 Left 941113123 2:161439742-161439764 CCAGCCTTAGCCAGGCGGGGTGC No data
Right 941113131 2:161439775-161439797 CCCAGCTACTTGGGAGGCTGAGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
941113123_941113129 4 Left 941113123 2:161439742-161439764 CCAGCCTTAGCCAGGCGGGGTGC No data
Right 941113129 2:161439769-161439791 AGTAGTCCCAGCTACTTGGGAGG 0: 370
1: 43429
2: 158045
3: 223579
4: 228861
941113123_941113134 14 Left 941113123 2:161439742-161439764 CCAGCCTTAGCCAGGCGGGGTGC No data
Right 941113134 2:161439779-161439801 GCTACTTGGGAGGCTGAGGTGGG 0: 12612
1: 103254
2: 205356
3: 262421
4: 281961
941113123_941113128 1 Left 941113123 2:161439742-161439764 CCAGCCTTAGCCAGGCGGGGTGC No data
Right 941113128 2:161439766-161439788 TGTAGTAGTCCCAGCTACTTGGG 0: 26
1: 109
2: 451
3: 5185
4: 67477
941113123_941113133 13 Left 941113123 2:161439742-161439764 CCAGCCTTAGCCAGGCGGGGTGC No data
Right 941113133 2:161439778-161439800 AGCTACTTGGGAGGCTGAGGTGG 0: 12605
1: 27761
2: 42780
3: 108181
4: 184073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941113123 Original CRISPR GCACCCCGCCTGGCTAAGGC TGG (reversed) Intronic
No off target data available for this crispr