ID: 941115426

View in Genome Browser
Species Human (GRCh38)
Location 2:161466822-161466844
Sequence CTTCAGATAGAGCTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941115426_941115430 3 Left 941115426 2:161466822-161466844 CCTTTCTCCAGCTCTATCTGAAG No data
Right 941115430 2:161466848-161466870 CCTCCCACTTTCTGGCCTACAGG No data
941115426_941115431 4 Left 941115426 2:161466822-161466844 CCTTTCTCCAGCTCTATCTGAAG No data
Right 941115431 2:161466849-161466871 CTCCCACTTTCTGGCCTACAGGG No data
941115426_941115435 27 Left 941115426 2:161466822-161466844 CCTTTCTCCAGCTCTATCTGAAG No data
Right 941115435 2:161466872-161466894 ATTTCTGTTCCTTATATCTCTGG No data
941115426_941115428 -5 Left 941115426 2:161466822-161466844 CCTTTCTCCAGCTCTATCTGAAG No data
Right 941115428 2:161466840-161466862 TGAAGTCTCCTCCCACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941115426 Original CRISPR CTTCAGATAGAGCTGGAGAA AGG (reversed) Intronic
No off target data available for this crispr