ID: 941118832

View in Genome Browser
Species Human (GRCh38)
Location 2:161504989-161505011
Sequence TTGAAGCCTGGAATTTTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941118832_941118837 15 Left 941118832 2:161504989-161505011 CCGCAAAAAATTCCAGGCTTCAA No data
Right 941118837 2:161505027-161505049 AAAGCAAAACAGTGAGGTGAAGG No data
941118832_941118836 9 Left 941118832 2:161504989-161505011 CCGCAAAAAATTCCAGGCTTCAA No data
Right 941118836 2:161505021-161505043 TACTAAAAAGCAAAACAGTGAGG 0: 1
1: 1
2: 1
3: 30
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941118832 Original CRISPR TTGAAGCCTGGAATTTTTTG CGG (reversed) Intronic
No off target data available for this crispr